ID: 1080792121

View in Genome Browser
Species Human (GRCh38)
Location 11:35530751-35530773
Sequence AAAGATCCCCATATGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080792117_1080792121 28 Left 1080792117 11:35530700-35530722 CCAAGAGAAGGTAATGGAGTACA No data
Right 1080792121 11:35530751-35530773 AAAGATCCCCATATGGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080792121 Original CRISPR AAAGATCCCCATATGGATCA AGG Intergenic
No off target data available for this crispr