ID: 1080797653

View in Genome Browser
Species Human (GRCh38)
Location 11:35580412-35580434
Sequence TAGAATATGGAGAAGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080797649_1080797653 0 Left 1080797649 11:35580389-35580411 CCTAGTAACTTGCTTCTAATCAA No data
Right 1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG No data
1080797648_1080797653 18 Left 1080797648 11:35580371-35580393 CCTTGAGTGCAGACTGTGCCTAG No data
Right 1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG No data
1080797647_1080797653 19 Left 1080797647 11:35580370-35580392 CCCTTGAGTGCAGACTGTGCCTA No data
Right 1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG No data
1080797646_1080797653 20 Left 1080797646 11:35580369-35580391 CCCCTTGAGTGCAGACTGTGCCT No data
Right 1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG No data
1080797645_1080797653 23 Left 1080797645 11:35580366-35580388 CCTCCCCTTGAGTGCAGACTGTG No data
Right 1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080797653 Original CRISPR TAGAATATGGAGAAGGAGAT GGG Intergenic
No off target data available for this crispr