ID: 1080798409

View in Genome Browser
Species Human (GRCh38)
Location 11:35587288-35587310
Sequence AAGCACCAAGATCAGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080798409_1080798414 7 Left 1080798409 11:35587288-35587310 CCTGATCCCTGATCTTGGTGCTT No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080798409 Original CRISPR AAGCACCAAGATCAGGGATC AGG (reversed) Intergenic
No off target data available for this crispr