ID: 1080798410

View in Genome Browser
Species Human (GRCh38)
Location 11:35587294-35587316
Sequence TTGGAGAAGCACCAAGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080798410_1080798414 1 Left 1080798410 11:35587294-35587316 CCCTGATCTTGGTGCTTCTCCAA No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080798410 Original CRISPR TTGGAGAAGCACCAAGATCA GGG (reversed) Intergenic
No off target data available for this crispr