ID: 1080798414

View in Genome Browser
Species Human (GRCh38)
Location 11:35587318-35587340
Sequence CCCCATTTTGTTCCTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080798409_1080798414 7 Left 1080798409 11:35587288-35587310 CCTGATCCCTGATCTTGGTGCTT No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data
1080798410_1080798414 1 Left 1080798410 11:35587294-35587316 CCCTGATCTTGGTGCTTCTCCAA No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data
1080798408_1080798414 8 Left 1080798408 11:35587287-35587309 CCCTGATCCCTGATCTTGGTGCT No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data
1080798411_1080798414 0 Left 1080798411 11:35587295-35587317 CCTGATCTTGGTGCTTCTCCAAG No data
Right 1080798414 11:35587318-35587340 CCCCATTTTGTTCCTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080798414 Original CRISPR CCCCATTTTGTTCCTGTTGT TGG Intergenic
No off target data available for this crispr