ID: 1080800235

View in Genome Browser
Species Human (GRCh38)
Location 11:35603523-35603545
Sequence AAACTAGCGCTGGATGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080800232_1080800235 20 Left 1080800232 11:35603480-35603502 CCAGGCTGCTGCTGTATGAAAAG No data
Right 1080800235 11:35603523-35603545 AAACTAGCGCTGGATGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080800235 Original CRISPR AAACTAGCGCTGGATGACAT TGG Intergenic
No off target data available for this crispr