ID: 1080802264

View in Genome Browser
Species Human (GRCh38)
Location 11:35619212-35619234
Sequence GGCGCGCCAGATAGTAAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080802264_1080802270 10 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802270 11:35619245-35619267 CCAGCGCCACGTGCCGCCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 127
1080802264_1080802272 16 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802272 11:35619251-35619273 CCACGTGCCGCCGCTGGCACTGG 0: 1
1: 0
2: 2
3: 7
4: 92
1080802264_1080802273 21 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802273 11:35619256-35619278 TGCCGCCGCTGGCACTGGCTCGG 0: 1
1: 0
2: 0
3: 9
4: 138
1080802264_1080802276 25 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802276 11:35619260-35619282 GCCGCTGGCACTGGCTCGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 157
1080802264_1080802274 22 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802274 11:35619257-35619279 GCCGCCGCTGGCACTGGCTCGGG 0: 1
1: 0
2: 2
3: 21
4: 219
1080802264_1080802278 28 Left 1080802264 11:35619212-35619234 CCTGTCTTACTATCTGGCGCGCC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1080802278 11:35619263-35619285 GCTGGCACTGGCTCGGGTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080802264 Original CRISPR GGCGCGCCAGATAGTAAGAC AGG (reversed) Exonic