ID: 1080807159

View in Genome Browser
Species Human (GRCh38)
Location 11:35663649-35663671
Sequence CTCAAATCAAGCCCATGGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080807159_1080807161 -9 Left 1080807159 11:35663649-35663671 CCGGACCATGGGCTTGATTTGAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1080807161 11:35663663-35663685 TGATTTGAGTACCTATTGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 87
1080807159_1080807162 -1 Left 1080807159 11:35663649-35663671 CCGGACCATGGGCTTGATTTGAG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1080807162 11:35663671-35663693 GTACCTATTGCCAGGAAGATAGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080807159 Original CRISPR CTCAAATCAAGCCCATGGTC CGG (reversed) Exonic
900610423 1:3542320-3542342 CTCGCATTAAGCCCATGGTTTGG - Intronic
902437201 1:16406047-16406069 CTCAAACCAAACCCTTGGCCTGG + Intronic
903479977 1:23645882-23645904 CCCACATCATGGCCATGGTCAGG + Intergenic
904317740 1:29676771-29676793 ATGAAATTAAGCCCATGGCCAGG + Intergenic
905193409 1:36254841-36254863 ACCAAATCTAGCCCATTGTCTGG - Intronic
905237305 1:36559000-36559022 CTCCAATCAGGCTCTTGGTCTGG + Intergenic
905298042 1:36966909-36966931 CTCAAAACAAGCACATTGTCTGG - Intronic
907611810 1:55878781-55878803 CTCAAAGCAAACTCAAGGTCAGG - Intergenic
908101649 1:60797214-60797236 CTCAAATCAAGCCTTTAATCAGG - Intergenic
1063507086 10:6609418-6609440 ATCAAATGAAGCCCAGGGTTGGG + Intergenic
1064282892 10:13967601-13967623 TTCAAATTAAGCCCATGGCTTGG - Intronic
1067470900 10:46536944-46536966 CTCATGTCAAGCCCAGGGACTGG - Intergenic
1067552102 10:47243493-47243515 CTCCTTTCAAGCCCATGATCTGG + Intergenic
1068510763 10:57963097-57963119 CTCAAATCAAGCCATTGACCGGG - Intergenic
1072253181 10:93597872-93597894 TTTAAAGCAAGACCATGGTCAGG + Intronic
1075118859 10:119649973-119649995 CTCAATTCAAACCCATGTTAAGG + Intergenic
1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG + Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1084901975 11:72316402-72316424 CTGAAATCAAGCCCAAGGAGTGG + Intronic
1086334445 11:85785684-85785706 CTTAAATGAGGCTCATGGTCTGG + Intronic
1090424176 11:126595481-126595503 CTCAAATCAAGGCCAAGTTTAGG - Intronic
1091305204 11:134532030-134532052 CCCAAAAGAAGCCCATGGGCAGG - Intergenic
1091902214 12:4153538-4153560 CTCACGTCCAGCCCATGGCCTGG + Intergenic
1093490059 12:19695814-19695836 CTCAACACAGGCCAATGGTCGGG + Intronic
1095492765 12:42752210-42752232 ATTAAACCAAGGCCATGGTCAGG + Intergenic
1102583043 12:113903926-113903948 CTCAACAGAATCCCATGGTCCGG - Intronic
1106787961 13:33126022-33126044 CTCAATCCAATCCCATGGTTGGG + Intronic
1109713257 13:66185942-66185964 CTCAAATCAATAGAATGGTCTGG - Intergenic
1110691996 13:78441735-78441757 CTCCAATCAAGCCCAGGTTAAGG + Intergenic
1112504068 13:99964883-99964905 CTCAAAAGCAGCCCATGGTATGG + Exonic
1114780714 14:25535593-25535615 CTCAAAGTAAGCACAAGGTCAGG - Intergenic
1118602042 14:67477627-67477649 CCTAAATCAAACCCATGGGCAGG + Intronic
1121415253 14:93774848-93774870 CTCAACTCAACCCCATGGGGTGG + Intronic
1121935115 14:98011593-98011615 CTCCAGTCAAACCCATGGACAGG + Intergenic
1122330754 14:100910914-100910936 CTCAGATCAAGCCAAGGGTTTGG - Intergenic
1122974049 14:105163832-105163854 CTCCAATCAGGCCTAGGGTCTGG + Intronic
1128383014 15:67127129-67127151 CTCAAATCAAGCCCAGACACCGG + Intronic
1131787629 15:95930158-95930180 CTCAAAGCAAGGGCATAGTCTGG - Intergenic
1133023698 16:2978205-2978227 TTCAAATCAAGCCAATTTTCAGG - Intronic
1134258666 16:12632564-12632586 TTCAAATAAAGCCCATAGTTTGG - Intergenic
1135251399 16:20903214-20903236 TTCAAATGAAGCCCAAAGTCTGG - Intronic
1137699092 16:50483030-50483052 CACAAAACAAGCCCAAGGGCTGG - Intergenic
1141693178 16:85607778-85607800 CTTAAATCCTGCCCAGGGTCTGG + Intergenic
1144791564 17:17862495-17862517 CTCCAATCAACCCCAAGGGCAGG + Intronic
1157109369 18:44805733-44805755 CTGAGCTCAAGGCCATGGTCAGG - Intronic
1162208741 19:9075349-9075371 CTCCAATCACGGCCATGGGCAGG + Intergenic
1166722874 19:45007560-45007582 CTAAAATCATGCCCATGGCCAGG + Intronic
1167231375 19:48286207-48286229 CTGAAATCAAGCACATGGACTGG + Exonic
1168578891 19:57536791-57536813 CTGAAAACAAACCCATGGCCTGG + Intronic
925320375 2:2961803-2961825 ACCAGATCAAGCCCATGCTCTGG + Intergenic
926868607 2:17387526-17387548 CTAAAATCAAGTCCATTTTCAGG + Intergenic
927258891 2:21066706-21066728 ATTAAAACAAGCCCATGGTGTGG + Intergenic
930073463 2:47388095-47388117 CACAATTCAAACCCATGTTCAGG + Intergenic
934489483 2:94750647-94750669 CTAAAATCAAACACATGGACAGG + Intergenic
936679281 2:114752106-114752128 CCCAAATGATGCCAATGGTCAGG + Intronic
937151794 2:119691292-119691314 CTCAAACCAACCCCAGGGGCTGG - Intergenic
945217450 2:207449170-207449192 TTCAACTCAAGGCCTTGGTCAGG - Intergenic
945979860 2:216300770-216300792 CTCAATTCATTCCAATGGTCTGG + Intronic
946028999 2:216690640-216690662 CTCAAATCCAGCCCAAGCCCCGG + Intronic
947722755 2:232379590-232379612 CTGCACTCAAGCCAATGGTCTGG - Exonic
947727094 2:232407671-232407693 CTGCACTCAAGCCAATGGTCTGG - Exonic
947736256 2:232456976-232456998 CTGCACTCAAGCCGATGGTCTGG - Exonic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1169043047 20:2511478-2511500 TTCAAATCCAGCCCTTGATCTGG + Intronic
1171061725 20:21970825-21970847 CTCAATTCAAGCCAATTGTGTGG + Intergenic
1171879427 20:30606590-30606612 CTAAAATCAAACACATGGACAGG + Intergenic
1173408020 20:42784052-42784074 CTCTAATGAAGCCTATGGGCTGG - Intronic
1173415437 20:42850800-42850822 CTCAAATCACTACCATGGTCAGG - Intronic
1173802166 20:45900891-45900913 CTCAAAACAAGCCCAAGGAGTGG + Intronic
1178430136 21:32511600-32511622 CACAAATCAAGACCATCGTAAGG + Intronic
1179632490 21:42687265-42687287 CGCAAAAATAGCCCATGGTCTGG + Intronic
1181792743 22:25280879-25280901 CTGAAATCAAGTCCCTGCTCTGG - Intergenic
1182973113 22:34596130-34596152 CTTAAAAGAAGCCCATGGGCTGG - Intergenic
954009205 3:47620110-47620132 CTCAAATTTAGCCCATGCTTAGG + Intronic
956004972 3:64769186-64769208 GTCAACTCCAGCCCATGGCCTGG + Intergenic
956952024 3:74293872-74293894 CTCAAACTAAGGCCATGGACAGG - Intronic
957731959 3:84150904-84150926 CTGTTATCAAGCACATGGTCAGG + Intergenic
958888525 3:99756392-99756414 ATCATATCAGGACCATGGTCTGG - Intronic
970732839 4:19127302-19127324 CTCAAATGAAGACCATGATGTGG + Intergenic
972670200 4:41207778-41207800 CTCAACTCAATCCCAAGGGCAGG + Intronic
975176881 4:71299635-71299657 CCCAAATCAAGCCTTTGTTCTGG - Intronic
979674976 4:123399655-123399677 CCCAAAGCAAGCCCACGGTCTGG - Intronic
984371435 4:178871443-178871465 CTGAGAGCCAGCCCATGGTCAGG - Intergenic
997704685 5:135937493-135937515 TTGAAATCAAGCCCAAGGTCTGG - Intronic
998051991 5:139043543-139043565 CTCAAATCCATTCCTTGGTCAGG - Intronic
1002695737 5:181087164-181087186 CTGACCTCAAGCCCATCGTCTGG - Intergenic
1006334416 6:33413086-33413108 CCCTCATCAAGACCATGGTCAGG + Intronic
1011502226 6:88003380-88003402 CTTAAATGCAGTCCATGGTCAGG - Intergenic
1011656201 6:89554210-89554232 CTGAAATCAAGCCACTGGTGAGG + Intronic
1018311257 6:162511642-162511664 TACTAATAAAGCCCATGGTCTGG + Intronic
1024299542 7:47876603-47876625 CTCAAGGGAAGGCCATGGTCTGG + Intronic
1029658679 7:101944597-101944619 CTCAAATCAAACCCAGGAGCCGG + Intronic
1030401561 7:109058156-109058178 CTAAAATCAACCACATGATCGGG - Intergenic
1031134161 7:117867824-117867846 CTCAAATCAACCACACTGTCTGG + Intronic
1038610665 8:29057693-29057715 CTGCATTCCAGCCCATGGTCTGG + Intronic
1045076443 8:98574374-98574396 CTCAAATCCAGGCAATAGTCAGG + Intronic
1046391775 8:113582689-113582711 ATTAATTCAAGCCCTTGGTCTGG - Intergenic
1047191285 8:122681279-122681301 CTCCAATCAGGCCCAAGGCCAGG + Intergenic
1047640345 8:126813128-126813150 TCCTAGTCAAGCCCATGGTCAGG + Intergenic
1048261787 8:132951504-132951526 CACATATCAAGCACATGCTCTGG - Intronic
1051166726 9:14270480-14270502 CTGATCTCAAGCCAATGGTCTGG - Intronic
1053668301 9:40333626-40333648 CTAAAATCAAACACATGGACAGG - Intergenic
1053918107 9:42959920-42959942 CTAAAATCAAACACATGGACAGG - Intergenic
1054379443 9:64473678-64473700 CTAAAATCAAACACATGGACAGG - Intergenic
1054516311 9:66042667-66042689 CTAAAATCAAACACATGGACAGG + Intergenic
1061205008 9:129157901-129157923 CTCAAATCCAACCCATGAGCAGG + Intergenic
1061615525 9:131776302-131776324 CTCAAATGATGCCCGTGGTAGGG - Intergenic
1186474859 X:9849391-9849413 CTAAAATCAATCCCATGGAAAGG - Intronic
1186924961 X:14323445-14323467 CTCAATTCTAACCCATGGGCCGG + Intergenic
1196978978 X:121190795-121190817 CTCAAACCAAGACCAGGGACTGG - Intergenic
1197397236 X:125941603-125941625 TACAAATCAAGTCCATGGACTGG - Intergenic