ID: 1080807913

View in Genome Browser
Species Human (GRCh38)
Location 11:35672622-35672644
Sequence GACTGAGGAACATTGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080807913 Original CRISPR GACTGAGGAACATTGGTGTC TGG Intronic
901443829 1:9294897-9294919 CACTGAGGAATTTTGGAGTCAGG + Intronic
906422086 1:45677319-45677341 GACAGAGGAAGATTCGTCTCAGG + Intronic
907940557 1:59083309-59083331 GACTCAGGATCATTGGAGCCTGG - Intergenic
908103246 1:60813018-60813040 AGTGGAGGAACATTGGTGTCTGG - Intergenic
910157583 1:84236669-84236691 GACTTAACAACATTGCTGTCAGG + Exonic
912236889 1:107862002-107862024 GTCTGAGGACCAGTGGTGTCAGG - Intronic
915327957 1:155091092-155091114 GGCTCAGGGTCATTGGTGTCTGG - Intergenic
919505393 1:198391877-198391899 AGCTGAGGAGCCTTGGTGTCAGG - Intergenic
923213508 1:231828390-231828412 GACTGAGTAACAGTAGTGGCTGG + Intronic
924454531 1:244208490-244208512 GACTGAGGCACAGTGGAGTTTGG - Intergenic
1063561771 10:7134808-7134830 GACTGTGGGAAATTCGTGTCTGG + Intergenic
1065390687 10:25177448-25177470 GACTGAGAAACCTTTGTGTGTGG + Intronic
1065467939 10:26045187-26045209 GACTGAGTACCAGTGGTGTCTGG + Intronic
1069577454 10:69541018-69541040 GACTGAGGAACAGAGGTGCCAGG + Intergenic
1072513229 10:96150021-96150043 GTCTGATTAATATTGGTGTCTGG + Intronic
1077437627 11:2550436-2550458 TAGGGAGGAACATGGGTGTCTGG - Intronic
1080807913 11:35672622-35672644 GACTGAGGAACATTGGTGTCTGG + Intronic
1082875197 11:57980708-57980730 GACTGAGGCACAGTTCTGTCTGG - Intergenic
1082959142 11:58902311-58902333 GACTGAGGAGAATTGGCTTCTGG - Intronic
1085468194 11:76738310-76738332 GACCCAGGAACATTGGCATCAGG + Intergenic
1087202528 11:95360168-95360190 GACTGTGGAAAGTTGGTGGCAGG + Intergenic
1088149075 11:106722109-106722131 GAAAGAGGAACATTTGTGCCTGG - Intronic
1088986637 11:114914912-114914934 GAAAGAGGAACACTGGGGTCTGG - Intergenic
1091999139 12:5018504-5018526 GACTGAGGAACTTCGGTTTGTGG + Intergenic
1093962228 12:25286971-25286993 GACTGAGGAACAAAGGAGACTGG - Intergenic
1097539034 12:60912948-60912970 GCCTTAGAAACATTGGAGTCAGG + Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1106292653 13:28379467-28379489 AAGTGAGGAAGAGTGGTGTCAGG + Intronic
1108494101 13:51007393-51007415 GAGGGAGGAAAATTGGTGGCAGG - Intergenic
1118014449 14:61644185-61644207 GAATGAGCAACTTTGGTGACAGG + Intronic
1118814266 14:69298796-69298818 GACTGAGGAGAGTTGGAGTCGGG + Intronic
1119150743 14:72357294-72357316 GACTTTGGAACATGGGTGACAGG + Intronic
1123119221 14:105909175-105909197 GACTGAGGCCCAGTGGGGTCTGG + Intergenic
1202901866 14_GL000194v1_random:48956-48978 GATTGAGCAATATTAGTGTCCGG + Intergenic
1124514013 15:30350776-30350798 GTCTGGGGGACTTTGGTGTCTGG - Intergenic
1124728908 15:32179989-32180011 GTCTGGGGGACTTTGGTGTCTGG + Intergenic
1126592855 15:50357040-50357062 GACTGAGGGAGATAGATGTCAGG + Intergenic
1127381538 15:58434726-58434748 GACTGGGGAACCTGGGTCTCAGG - Intronic
1129174661 15:73831288-73831310 GACTGAGGAACAGGGGGGTCTGG + Intergenic
1130405121 15:83592574-83592596 GCCGTGGGAACATTGGTGTCAGG + Intronic
1134775887 16:16853202-16853224 GACTGAAAAACATTGCTGTAGGG + Intergenic
1136561036 16:31039457-31039479 GACTGAAGAACATTCCTGGCAGG - Intronic
1139727174 16:68910517-68910539 AATTAAGGAACAATGGTGTCAGG + Intronic
1143658348 17:8310525-8310547 GGCTGAGCAGCATGGGTGTCTGG - Intronic
1144947366 17:18976798-18976820 GCCTGAGGGACACTTGTGTCAGG - Intronic
1149696229 17:58618385-58618407 GAATGAGCAACATCAGTGTCTGG - Intronic
1153927678 18:9848675-9848697 GACTGTGGAACATTGCTTTGGGG - Intronic
1159479874 18:68975872-68975894 GTCTGATCTACATTGGTGTCAGG - Intronic
1161682724 19:5687970-5687992 GAGGGAGGAACATTGCCGTCTGG - Exonic
1162927459 19:13937545-13937567 GACTGAGGATTAGTGGTGTTAGG - Intronic
1164116383 19:22223235-22223257 GATTGAGGAACATTCTTTTCAGG - Intergenic
1165845051 19:38812770-38812792 GAGTGGGGAAAATTGGTGTGAGG + Intronic
1167293789 19:48637930-48637952 GAAAGAGGAAGATTGGTTTCCGG + Exonic
1167530273 19:50011627-50011649 GAGTGAGGAACATTTCTGCCTGG - Intronic
1168348914 19:55664651-55664673 GACGGAGGCACATCTGTGTCAGG + Intronic
1168485482 19:56758834-56758856 AACGGGGGGACATTGGTGTCAGG + Intergenic
938068305 2:128293479-128293501 GTATGAGGAACAGTGGTTTCTGG - Intronic
942047668 2:172109266-172109288 AACTGAGGACCATTTGTGCCCGG + Intergenic
1169985495 20:11438940-11438962 GACTGAGGAATATGGGTGACAGG - Intergenic
1170647108 20:18207399-18207421 GACTGAGAACCATAGGTGTGCGG + Intergenic
1173958271 20:47051620-47051642 GACCCAGGAACACTGGGGTCCGG - Intronic
1176621234 21:9063723-9063745 GACTGAGCAATATTAGTGTCCGG + Intergenic
1178705797 21:34871780-34871802 GACTGAGCCATTTTGGTGTCTGG + Intronic
1179447924 21:41446259-41446281 GAATCAGGAAATTTGGTGTCTGG + Intronic
1182120879 22:27785891-27785913 GTCTAATGGACATTGGTGTCTGG - Intronic
952768231 3:36974011-36974033 GACAGAGGAACATTGCCCTCTGG - Intergenic
954201391 3:49025386-49025408 GGCTGAGGAACAGACGTGTCTGG + Intronic
961912140 3:130328958-130328980 GTCTGATGAACAGTGCTGTCTGG - Intergenic
971519213 4:27528465-27528487 GACTCATGAACATTGGTGAGTGG - Intergenic
976925871 4:90494777-90494799 GACTTAGGACCATAGGTGTTAGG - Intronic
984600069 4:181715917-181715939 GACTGATGAACAGTGGAGTCAGG - Intergenic
985067482 4:186137331-186137353 GAGTAAGGTACATTGGTCTCTGG + Intronic
985569592 5:637776-637798 GACTGAGGAGCAGAGGTCTCGGG + Exonic
986726534 5:10602142-10602164 GACTGAGCAACCTCGGTGCCTGG + Intronic
986769697 5:10961310-10961332 GGCTTAGGAACAGTGGTGTCTGG - Intergenic
987320624 5:16766115-16766137 CCCTGAGGAACATTGATCTCTGG + Exonic
988946228 5:36203500-36203522 GACTGAGCAACGAAGGTGTCAGG + Intronic
991429206 5:66526309-66526331 GAGTGAGGAACATGGATGTAGGG - Intergenic
993470416 5:88300990-88301012 CACTAAGGATCATTGGTGTCAGG - Intergenic
994507335 5:100658732-100658754 GGCTGAGAAACATTTGTGTTGGG - Intergenic
996397247 5:123025857-123025879 AACTGAGAGCCATTGGTGTCAGG + Exonic
998017862 5:138746840-138746862 GGCTGAGGATCATTTGAGTCTGG + Intronic
1001604734 5:172951571-172951593 GGCTGAGGCACATTGGTGGAGGG - Exonic
1007640347 6:43334044-43334066 GACTGAGGAAGAATGGGGTGGGG - Intronic
1009753210 6:67899708-67899730 GACTCATGAACAAAGGTGTCTGG - Intergenic
1010554905 6:77266917-77266939 CACTGGTGCACATTGGTGTCTGG + Intergenic
1011801326 6:91019309-91019331 CACTGAGGTATATTGGTGTGAGG - Intergenic
1013679922 6:112513796-112513818 GACTAAGACACATTGATGTCTGG + Intergenic
1014829350 6:126083309-126083331 GGCTTAGGTACATTGGGGTCAGG - Intergenic
1016387497 6:143542667-143542689 AACAGAGGAAGATTGCTGTCAGG - Intronic
1019109451 6:169698208-169698230 CACTGAGGAACAGAGGTGTTGGG - Intronic
1019357104 7:586251-586273 GAGTGAGGATCATTGGGGGCCGG - Intronic
1025115522 7:56254836-56254858 GTCTGAGGAACATAGGTGCAAGG - Intergenic
1026881715 7:73910279-73910301 GAGTGAGTGACATTGGTGTGAGG - Intergenic
1029188896 7:98758304-98758326 GAATGAGCCACATGGGTGTCTGG + Intergenic
1030348583 7:108458440-108458462 CACTGAGAAACATTGATTTCTGG + Intergenic
1035070108 7:156138379-156138401 GTCTGAGGACCACTGGGGTCAGG - Intergenic
1036756276 8:11473267-11473289 GACTGATGAACACTGGTGTGGGG + Intronic
1038330729 8:26607120-26607142 GAATGATGAAAATTGGTGACTGG + Intronic
1038351225 8:26777898-26777920 GACTGAGGCACGTTGGTCTATGG + Intronic
1040761357 8:50849327-50849349 GACTGAGGAGCAGTAGTGCCGGG - Intergenic
1040823593 8:51592051-51592073 GACTCAGAAACATTGGTGTTTGG - Intronic
1045349193 8:101322792-101322814 GACTGAGGCACATAGGGGTCAGG - Intergenic
1047809102 8:128388630-128388652 GACAGAGGTATCTTGGTGTCAGG + Intergenic
1048089277 8:131221210-131221232 GAATGCAGAACTTTGGTGTCAGG + Intergenic
1049086336 8:140481225-140481247 CACTTAGGCACATTGTTGTCAGG + Intergenic
1049808716 8:144553614-144553636 GACAGAGGTCCAGTGGTGTCTGG - Intronic
1055980258 9:81993912-81993934 GATTGAAGAGCATTGGTGACAGG - Exonic
1056196111 9:84230340-84230362 GACTTAGGAACAAGGGTGTCAGG + Intergenic
1057211844 9:93204795-93204817 CAGGGAGGAACATGGGTGTCTGG + Intronic
1059195079 9:112363473-112363495 GGCTGAGGTGCATTGGTGTGTGG - Intergenic
1061712143 9:132495572-132495594 TCTTGAGGAACATTGGGGTCTGG + Intronic
1187499473 X:19827613-19827635 GACTAAAGAACAATGTTGTCTGG + Intronic
1190360476 X:49644379-49644401 CACTGGGGAACAGTGGTGCCTGG + Intergenic
1196551841 X:117037613-117037635 GACTGAGGGAGATTAGGGTCAGG - Intergenic
1201157773 Y:11149177-11149199 GATTGAGCAATATTAGTGTCCGG + Intergenic