ID: 1080808392

View in Genome Browser
Species Human (GRCh38)
Location 11:35678063-35678085
Sequence TGGAGTATAATCAGTAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080808385_1080808392 19 Left 1080808385 11:35678021-35678043 CCTGAGATAGAACAAGTTTACTA 0: 1
1: 0
2: 0
3: 16
4: 121
Right 1080808392 11:35678063-35678085 TGGAGTATAATCAGTAGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 101
1080808384_1080808392 20 Left 1080808384 11:35678020-35678042 CCCTGAGATAGAACAAGTTTACT 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1080808392 11:35678063-35678085 TGGAGTATAATCAGTAGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080808392 Original CRISPR TGGAGTATAATCAGTAGTGG TGG Intronic
905982489 1:42241954-42241976 TGGGCTATAGTCATTAGTGGAGG - Intronic
906234950 1:44200692-44200714 TGGAGTATCATCAACAGTGAAGG - Intergenic
906694143 1:47812815-47812837 TGGAAGACATTCAGTAGTGGAGG + Intronic
908456608 1:64310338-64310360 GGGAGTATATTCAGGAATGGTGG - Intergenic
909572409 1:77130653-77130675 AGGAGTATGAACAGTAGTGGTGG - Intronic
909773272 1:79453033-79453055 TAGATTTGAATCAGTAGTGGAGG - Intergenic
910433805 1:87184816-87184838 TGGAGGAAAATCAGTATTGAAGG + Intergenic
912271209 1:108210689-108210711 TGGATTATAATTAGTAGTAGTGG + Intergenic
915942616 1:160128547-160128569 TGGAGTAGAATCAGGGGAGGAGG + Intronic
917658587 1:177154140-177154162 TGGAGTATTATTTGTAGTGACGG + Intronic
920700649 1:208215932-208215954 TGGAGAAGAATCAGGAGTGTGGG - Intronic
922952946 1:229574402-229574424 AGGAGTTTAATCAATGGTGGAGG - Intergenic
1069243261 10:66168917-66168939 TGGACTATAATCTCTAGTGAGGG - Intronic
1070698514 10:78581431-78581453 GGGACTATAGTCAGCAGTGGGGG - Intergenic
1072324219 10:94280871-94280893 TGCAGTATAACCAGTGATGGAGG - Intronic
1073815009 10:107196878-107196900 TGGAATATAATTAGTATTTGAGG + Intergenic
1075396259 10:122129854-122129876 TGGAGAATAAGCAGTAGTGTGGG + Intronic
1080808392 11:35678063-35678085 TGGAGTATAATCAGTAGTGGTGG + Intronic
1089001992 11:115059865-115059887 AGCAGTACAAACAGTAGTGGAGG + Intergenic
1090085433 11:123646112-123646134 TGGATTTTAATGAGTGGTGGTGG - Intronic
1093849439 12:24017945-24017967 TGGATCCTAATCATTAGTGGGGG - Intergenic
1098540944 12:71656886-71656908 TTGACTAGAATCAGTAGTGTCGG + Exonic
1099757190 12:86867512-86867534 TGGATTATAATCAGTAAAAGGGG - Intergenic
1100481542 12:94984157-94984179 TGGAGTGTAAACTGTAGTGCTGG + Intronic
1102905057 12:116668058-116668080 TGGACTATAATAAGTGGAGGAGG + Intergenic
1105794383 13:23835591-23835613 TCTAGTATAATCAGAATTGGAGG + Intronic
1106482080 13:30144177-30144199 TGGAATGTAAGCAGAAGTGGTGG - Intergenic
1106573774 13:30955757-30955779 TGGAGTAGACTCAGTAGAGAGGG + Intronic
1117513982 14:56482187-56482209 TGTATTATAATCAGTAGCTGTGG - Intergenic
1119364014 14:74076277-74076299 TGGAGTAAAATCAGTAAACGGGG + Intronic
1120709857 14:87781742-87781764 TGGAGTCTAATCAGTTTTGTGGG + Intergenic
1124233907 15:27970391-27970413 TGGGGGAAAAGCAGTAGTGGAGG + Intronic
1128864788 15:71106313-71106335 TGGAGAATACTCAGGAATGGTGG - Intronic
1133147671 16:3802038-3802060 TGGAGTATACACAGTGGTTGAGG - Intronic
1134793607 16:17013883-17013905 TGGAGTGAACTCAGTAGAGGCGG + Intergenic
1134885460 16:17786927-17786949 TGGAATAGAATCAGCAGTGAGGG - Intergenic
1136607695 16:31347632-31347654 TGGATTATAATCTGCAGTGTTGG - Intergenic
1140204941 16:72925890-72925912 TGTTATATAATGAGTAGTGGGGG - Intronic
1140977401 16:80073133-80073155 TGGAGAATAATCAGGATTCGGGG - Intergenic
1143310684 17:5985983-5986005 TTGAGTATACTGAGTAGTGGGGG - Intronic
1149070282 17:52533713-52533735 TGGAGTATAATCAGTTTTTATGG - Intergenic
926291674 2:11536108-11536130 TGGAGCATACACAGGAGTGGTGG + Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928391539 2:30914585-30914607 TGGTGTAGAATCAGGAGTGTGGG - Intronic
929289082 2:40168972-40168994 TGGAATAGAATCACCAGTGGGGG + Intronic
933417753 2:82008521-82008543 AGCAGTATTATCAGTAGTGACGG + Intergenic
937379740 2:121365738-121365760 TGGAGGATAATCAGATGTGATGG - Intronic
941319657 2:164039146-164039168 TGGATTATAATCCCTAGTGTTGG - Intergenic
941689308 2:168482271-168482293 TGGATTAAAATCAGTTATGGTGG + Intronic
942949927 2:181711012-181711034 TGGAGTATATACTTTAGTGGAGG + Intergenic
943154994 2:184164799-184164821 AAGAGAAAAATCAGTAGTGGTGG - Intergenic
1170964696 20:21056326-21056348 TTAAGTGTAATCACTAGTGGTGG + Intergenic
1174221280 20:48957494-48957516 TGGTGCCTAATCAGTAGTGGTGG + Intronic
1177733096 21:25053963-25053985 TGAAGTCTAATAAATAGTGGAGG - Intergenic
1178516282 21:33250160-33250182 TGGATTATAATCAGTACTCTAGG + Intronic
1181870291 22:25892810-25892832 TGGTATAAAATCAGTAGTGTGGG + Intronic
950633900 3:14302023-14302045 GGGAGTAGAATCAATAGGGGTGG - Intergenic
955618065 3:60830062-60830084 TGGGGGATAGTCAGTTGTGGAGG - Intronic
956027814 3:65002409-65002431 TGCAGTAGAAGCAGGAGTGGTGG + Intergenic
956068913 3:65427024-65427046 AGGAGTATAGTCAGGTGTGGTGG + Intronic
963201989 3:142595715-142595737 TGAAGCATAATCCGTAGTTGTGG - Intergenic
963647354 3:147932112-147932134 TGGAATATAATAAGGAGTGCTGG - Intergenic
964592748 3:158383652-158383674 AGGGGTGTAATAAGTAGTGGTGG + Intronic
970516093 4:16831803-16831825 TGGAGTATCAGCAGAAGTAGTGG + Intronic
970798880 4:19948187-19948209 TAGAGTATAATGAGCAGTGAGGG + Intergenic
971512179 4:27440464-27440486 TGGAGTCTCAACAATAGTGGTGG - Intergenic
971714187 4:30153832-30153854 TGGAGCAGAACCAGGAGTGGGGG + Intergenic
974219136 4:58943790-58943812 TAGAGAATAATCAGCAGTAGAGG + Intergenic
977971487 4:103218495-103218517 TGGAGTATACCCACTAGTAGTGG + Intergenic
979673036 4:123381646-123381668 TGAAGTATAATCCCTAGTGCTGG + Intergenic
981239641 4:142461489-142461511 TGAAGTATAATCAGGATTTGAGG + Intronic
982339105 4:154275424-154275446 TGGATTATAATCAATCATGGTGG + Intronic
984568488 4:181360784-181360806 TGAAGTAAAATCAGCAGTGAAGG + Intergenic
984872986 4:184343783-184343805 TGGAGTTTCAACAGCAGTGGGGG - Intergenic
986398359 5:7353719-7353741 CAGAGTATACTCTGTAGTGGAGG + Intergenic
986812184 5:11372402-11372424 CGGAGTATAATGAGTAATGTGGG + Intronic
988495559 5:31742554-31742576 TGGGGTAGAAACAGTGGTGGGGG - Intronic
992030520 5:72716869-72716891 AGGAGTACGATCTGTAGTGGAGG + Intergenic
994553909 5:101272312-101272334 TGGAGTTTAAACAGTTGTGAAGG - Intergenic
995192430 5:109331739-109331761 TGGAGTATTTGCAGTTGTGGAGG + Intergenic
998599636 5:143572129-143572151 TGGATTAAAATCAGTAGAGAAGG - Intergenic
999523403 5:152376363-152376385 TGGAGAACAGTCAGAAGTGGGGG + Intergenic
1006692692 6:35903339-35903361 TGTAGTATTTTCAGTAGAGGTGG - Intronic
1008730169 6:54472778-54472800 TGGAGTACAATGAATACTGGAGG + Intergenic
1009436445 6:63623648-63623670 TGGAGTAAAATTGGTAGTGAGGG + Intergenic
1026140769 7:67704339-67704361 TGGAATATGAACAGGAGTGGAGG + Intergenic
1026952759 7:74358510-74358532 TGCAGTATAATAAGTAGCCGGGG - Intronic
1027581668 7:80004599-80004621 TGGAGCAAAATGAGCAGTGGTGG + Intergenic
1028007929 7:85601098-85601120 TGGAGTATAATTGGTAGTTTTGG - Intergenic
1030641748 7:112013889-112013911 GTGAGTATAATCAGTGTTGGAGG - Intronic
1034326775 7:150242767-150242789 AGGAGTATCAGCAGTGGTGGTGG + Intergenic
1034766431 7:153726498-153726520 AGGAGTATCAGCAGTGGTGGTGG - Intergenic
1035325216 7:158061542-158061564 TGCAGCATAAACAGTCGTGGTGG + Intronic
1036807422 8:11845166-11845188 TGGAATCGAATCAGAAGTGGTGG - Exonic
1039477006 8:37844315-37844337 TGGAGTAAAGTCAGGAGTGCAGG - Exonic
1039793863 8:40896160-40896182 TGGAGGAGAATCTGTTGTGGTGG + Intronic
1041007611 8:53510440-53510462 TGGAGTAAAATCGAGAGTGGAGG - Intergenic
1046767223 8:118082943-118082965 GAGAGTGTAATCAGTAGTGCTGG - Intronic
1047233352 8:123016714-123016736 TGTAGTATAACAAGTAGTGCAGG - Intronic
1047986782 8:130243577-130243599 TGGAACATAATGAGTAGTGGAGG - Intronic
1060958768 9:127664254-127664276 TGGAGTATAAGCAGGAGTCAGGG + Intronic
1062643463 9:137533968-137533990 TGGAGTATACACTGTTGTGGAGG - Intronic
1197453902 X:126653061-126653083 AGGAATATAAACAGGAGTGGTGG - Intergenic
1197925983 X:131647294-131647316 TGGAGCATAAACAGCAGTGTGGG + Intergenic
1198000224 X:132426681-132426703 GGGATTATATTCAGCAGTGGTGG - Intronic
1199726252 X:150585318-150585340 CTGAGCAGAATCAGTAGTGGAGG - Intronic
1200374672 X:155767379-155767401 TGGTATATAATCTGCAGTGGGGG - Intergenic
1201981815 Y:19917084-19917106 TGGAGGAGAGTCAGTAGGGGTGG + Intergenic