ID: 1080809506

View in Genome Browser
Species Human (GRCh38)
Location 11:35689188-35689210
Sequence GCCTACACCTCAACCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080809506_1080809512 24 Left 1080809506 11:35689188-35689210 CCTGCCATGGTTGAGGTGTAGGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1080809512 11:35689235-35689257 CAGGAACAACCAGCCATTATGGG 0: 1
1: 0
2: 0
3: 14
4: 102
1080809506_1080809508 -4 Left 1080809506 11:35689188-35689210 CCTGCCATGGTTGAGGTGTAGGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1080809508 11:35689207-35689229 AGGCTGAGTTCTAAAACCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 168
1080809506_1080809509 5 Left 1080809506 11:35689188-35689210 CCTGCCATGGTTGAGGTGTAGGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1080809509 11:35689216-35689238 TCTAAAACCAGAGGAAAATCAGG 0: 1
1: 0
2: 0
3: 24
4: 287
1080809506_1080809511 23 Left 1080809506 11:35689188-35689210 CCTGCCATGGTTGAGGTGTAGGC 0: 1
1: 0
2: 2
3: 6
4: 96
Right 1080809511 11:35689234-35689256 TCAGGAACAACCAGCCATTATGG 0: 1
1: 0
2: 2
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080809506 Original CRISPR GCCTACACCTCAACCATGGC AGG (reversed) Intronic
904268284 1:29330722-29330744 GCCTGCACCCCCACCCTGGCTGG + Intergenic
904428941 1:30449539-30449561 GCCTGCACCCCCACCCTGGCTGG - Intergenic
907074456 1:51565781-51565803 GCCTACACCTCAACTCAGGCTGG + Intergenic
907387092 1:54133086-54133108 GCCTCCGCCTCATCCATGGGTGG + Intronic
913230910 1:116740293-116740315 TCCTTCACCTCCACCTTGGCAGG + Intergenic
914829087 1:151157536-151157558 GCCAACACCTCAAGAAGGGCAGG - Intronic
919067673 1:192713969-192713991 GCCAACAACTCACCCATGGGAGG + Intergenic
919880921 1:201900075-201900097 GCCTCCTCCTCCACCTTGGCCGG + Exonic
1062938649 10:1406129-1406151 ATCCACACCTCCACCATGGCTGG - Intronic
1067668611 10:48299999-48300021 GCTTATTCCTCAAGCATGGCTGG + Intergenic
1076500775 10:130934398-130934420 GGCTAGACTCCAACCATGGCAGG + Intergenic
1080809506 11:35689188-35689210 GCCTACACCTCAACCATGGCAGG - Intronic
1081588258 11:44402500-44402522 GCCTCAACCTCCACCATGCCTGG + Intergenic
1088491426 11:110392145-110392167 GCCTTCACATCAACCATGTGAGG + Intergenic
1089693373 11:120200272-120200294 TCCTGGACCTCAACCATGGAGGG - Intergenic
1090978250 11:131694097-131694119 GCCTTCACAGCAACCTTGGCAGG - Intronic
1098813751 12:75130046-75130068 CCCTACACTTAAAACATGGCAGG - Intronic
1099801904 12:87468074-87468096 GCTAACACCTCCACCATGGGAGG - Intergenic
1102446921 12:113010150-113010172 CCCTACACCCCAACCCTGGGGGG + Intronic
1104866492 12:131958960-131958982 GCCTTCACCTCAACCCTGGCTGG - Intronic
1105394521 13:20017245-20017267 GCCTAGACTTCCACCCTGGCCGG - Intronic
1108465787 13:50714210-50714232 CCCTAGACCTCAGGCATGGCGGG - Intronic
1113710482 13:112461332-112461354 GCTTCCACCTCCCCCATGGCTGG - Intergenic
1118818786 14:69331313-69331335 GGCCACCCCTCAACCCTGGCAGG - Intronic
1122534308 14:102451540-102451562 GCCAACAGATCAACCAAGGCTGG - Intronic
1123126017 14:105946772-105946794 GCCTACATCTCCACCATAGATGG - Intergenic
1123406603 15:20023194-20023216 GCCTACACCTCCACCATAGATGG - Intergenic
1123515933 15:21029842-21029864 GCCTACACCTCCACCATAGATGG - Intergenic
1124003356 15:25777505-25777527 CCCAACCCCTGAACCATGGCAGG - Intronic
1152255371 17:79235972-79235994 GTCTGCATCTCAAGCATGGCTGG + Intronic
1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG + Intergenic
1159586894 18:70289701-70289723 GCCTGCACCTCCACCAGCGCCGG - Intronic
1161653248 19:5497989-5498011 GCCCCCACCCCAACCCTGGCAGG - Intergenic
1163435819 19:17294499-17294521 GCCTCCACCACCACCAGGGCCGG - Exonic
1165100979 19:33438593-33438615 GCCGACAGCCCAACCCTGGCAGG + Intronic
1165445895 19:35856663-35856685 GCCTGCCCCTCAACCCCGGCAGG + Intronic
1167425363 19:49427409-49427431 GCCTTCAGCTCAACCATTCCTGG - Exonic
925703394 2:6661448-6661470 GCCTCCATCTCCCCCATGGCAGG + Intergenic
926328437 2:11805262-11805284 GGCTGCACCTCAACCAGGGAGGG + Intronic
926900005 2:17740419-17740441 GCCAACACCTCATTCTTGGCAGG + Intronic
932346022 2:70995492-70995514 GCCTGCACCTCACCCCTTGCCGG + Intergenic
933849208 2:86352231-86352253 GCCAGCACCTCAACCATCACAGG - Intergenic
935224638 2:101042916-101042938 GACCTCACCTCAACCATGCCAGG + Intronic
935789994 2:106582199-106582221 GCCTCCACCCCACGCATGGCAGG + Intergenic
938992924 2:136647760-136647782 GGCTCCACCTCAACCAAGACAGG + Intergenic
943111340 2:183610007-183610029 ACATGCACCTCAACCATGGCTGG - Intergenic
946339257 2:219057746-219057768 GCCTACACCTGCACCTCGGCCGG - Intronic
948933015 2:241144417-241144439 GCCAATACCAGAACCATGGCTGG + Intronic
1169293809 20:4375426-4375448 GGCTACACCTGGACCATGGCAGG - Intergenic
1170486463 20:16821498-16821520 GCCTACACGTCCCACATGGCAGG - Intergenic
1170728999 20:18955862-18955884 GCCTAGACCCAGACCATGGCAGG - Intergenic
1170888514 20:20360396-20360418 GCCTACAACTAAACGATGCCTGG - Exonic
1171994756 20:31723033-31723055 GCCTCCACCTCACCCTGGGCTGG - Intronic
1175459743 20:59143512-59143534 GCCTTCACTCCAGCCATGGCAGG + Intergenic
1175677913 20:60962552-60962574 GCCCTCACCCCAGCCATGGCGGG + Intergenic
1179424684 21:41266544-41266566 ACCTCCACCTCAAACGTGGCTGG - Intronic
1180103396 21:45600727-45600749 GCAGATACCTCAAGCATGGCTGG + Intergenic
1180205117 21:46255106-46255128 GCCGACACCTCACACATGCCAGG - Intronic
1181750006 22:24982728-24982750 GCCAACACCACGACCTTGGCAGG - Intronic
1182242842 22:28930869-28930891 GCCTCCACCTTCAGCATGGCAGG - Intronic
1182322997 22:29490371-29490393 TCCTTCACCTCCACCTTGGCAGG - Exonic
1183384530 22:37507423-37507445 GCCCACCCCACAACCTTGGCAGG + Intronic
1183724180 22:39579265-39579287 GCCAACTCTCCAACCATGGCTGG + Intronic
952981306 3:38738349-38738371 GCCCACATCTCTTCCATGGCTGG + Intronic
961580428 3:127876184-127876206 GCCAACACCTTGATCATGGCCGG + Intergenic
965733091 3:171792846-171792868 GGCTCCACCTCAGCCATAGCTGG - Intronic
965932135 3:174057616-174057638 GGCCACACCAAAACCATGGCAGG - Intronic
967092437 3:186146532-186146554 GCCTACACCTCAACACTCCCAGG - Intronic
974059848 4:57022224-57022246 GCCTACACGTGAAACATGCCAGG + Exonic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
982789792 4:159577513-159577535 GCCTAAACCTCAACCAAGGCAGG + Intergenic
983399602 4:167246065-167246087 TCTTACACATCAAACATGGCAGG + Intergenic
989004232 5:36792164-36792186 GCCTAAACTTCTAGCATGGCAGG - Intergenic
990134632 5:52630801-52630823 GCCTACATGTCAGCAATGGCTGG + Intergenic
992355428 5:75977616-75977638 GCCTTCTCCTCACCCATAGCGGG + Intergenic
994088870 5:95790802-95790824 GGCTACACCTAAACCATAGATGG - Intronic
995536805 5:113144684-113144706 GCCTGCACCTCAACAACAGCTGG + Intronic
999324177 5:150632885-150632907 GCCTTCATCACAGCCATGGCAGG + Intronic
1006716154 6:36122094-36122116 GCCCAAACCTCTGCCATGGCAGG + Intergenic
1007522442 6:42461644-42461666 GCCCCCACCACTACCATGGCCGG + Intergenic
1019229016 6:170542174-170542196 GTCTACGCCTAAACCATGGCAGG + Intronic
1022843573 7:34188877-34188899 GCTTAAACCCCAACCATGGGGGG - Intergenic
1023764059 7:43494321-43494343 ACCTAAACTTGAACCATGGCAGG - Intronic
1026205022 7:68249318-68249340 TGCTACACCTGAACCATGGTGGG + Intergenic
1026642627 7:72140574-72140596 GATTACACCCCAACCTTGGCAGG + Intronic
1032600305 7:133286840-133286862 GCCTCCCTCTCAACCATGCCTGG + Intronic
1037280473 8:17236146-17236168 ACCTACAACTCAACCATTTCTGG + Intronic
1038191954 8:25330501-25330523 CACTACAGCCCAACCATGGCAGG - Intronic
1038792579 8:30681377-30681399 GCCTGCACCACCACCATGCCTGG - Intronic
1041536197 8:58927894-58927916 GCCTGCACTTGAACCCTGGCAGG - Intronic
1044106939 8:88221080-88221102 GCCCCCAGCTCTACCATGGCTGG - Intronic
1044115442 8:88328371-88328393 GCCTACTCCTCAAGCCTGGAAGG - Intergenic
1045884610 8:107080434-107080456 GCCTCTACCTCTACCAGGGCTGG - Intergenic
1047940165 8:129821800-129821822 CCATACACCTCAACCACTGCAGG + Intergenic
1049091671 8:140519455-140519477 GCCTGCACCACCACCATGCCCGG - Intergenic
1056783649 9:89572032-89572054 GCCTCCATCTCCACCATGCCTGG - Intergenic
1056819059 9:89824174-89824196 GTCTCCACCTCAGGCATGGCAGG + Intergenic
1060435598 9:123590123-123590145 TCCTAGACCTCAGCCATGCCTGG + Intronic
1195693520 X:107649228-107649250 GCATACACCACAACCACGCCTGG + Intronic
1199731940 X:150642634-150642656 GACTACACCCCTACCCTGGCTGG + Intronic
1201796462 Y:17901894-17901916 GCCTACTCCTCCACAATGGAGGG - Intergenic
1201805093 Y:18004091-18004113 GCCTACTCCTCCACAATGGAGGG + Intergenic
1202198957 Y:22326918-22326940 GCAGACTCCTCAACCATGGTTGG - Intronic
1202357846 Y:24070958-24070980 GCCTACTCCTCCACAATGGAGGG - Intergenic
1202512932 Y:25599155-25599177 GCCTACTCCTCCACAATGGAGGG + Intergenic