ID: 1080819574

View in Genome Browser
Species Human (GRCh38)
Location 11:35792586-35792608
Sequence CCCAGAAGGAGGGATTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080819574 Original CRISPR CCCAGAAGGAGGGATTTCAC TGG (reversed) Intronic
900139245 1:1132589-1132611 CCCTGAGGGAGGGCGTTCACCGG - Intergenic
901499672 1:9644055-9644077 CCCATAAGAAGGGTTATCACAGG - Intergenic
904732734 1:32607030-32607052 GCTTGAAGGGGGGATTTCACTGG + Intronic
905210773 1:36372734-36372756 CTCAGAATGAGGCATTTCAGGGG + Intronic
905541600 1:38764548-38764570 CCCTGGAGGAGGCATTGCACAGG - Intergenic
909977988 1:82067754-82067776 GCCAGGAGAAGGGAATTCACAGG + Intergenic
910198929 1:84677677-84677699 CCCAGGAGGAGGGATTTAAGAGG - Intronic
911935184 1:103960794-103960816 GCTTGAAGGTGGGATTTCACTGG + Intergenic
911984421 1:104602503-104602525 GCCAGAAGAAGCAATTTCACAGG - Intergenic
912721026 1:112020236-112020258 CCAGGAAGTAGGGAGTTCACAGG - Intergenic
912985657 1:114427198-114427220 CCCAGAAGGTGGGATCACAATGG + Exonic
917098314 1:171421965-171421987 GCTTGAAGGAGGGGTTTCACTGG + Intergenic
921101510 1:211932875-211932897 CCCAGCAGGAGGGCTTTGCCTGG - Intergenic
924053686 1:240103481-240103503 CCCAGAAGGAGGGTGTTAAGAGG - Intronic
924404595 1:243730014-243730036 CCCTGAAGGTTGGGTTTCACTGG - Intronic
924581074 1:245324633-245324655 CAAAGCAGGAGGGATTTCAAGGG - Intronic
924738677 1:246781597-246781619 CACAGGAGGAGGGATTCCAGAGG + Intergenic
1070797737 10:79226617-79226639 CCCCAGAGGAGGGATTTCAGGGG + Intronic
1070985659 10:80687665-80687687 CCCAGAAGCAGGTACTTCAAGGG - Intergenic
1071439501 10:85677972-85677994 TACAGAAGAAGGGATTTAACTGG + Intronic
1071891142 10:90008716-90008738 TCCAGAAGGTGGAATTTAACAGG + Intergenic
1073056509 10:100706739-100706761 CTCAGAAAGAGGGGTGTCACTGG + Intergenic
1075838263 10:125474768-125474790 CCCAGAGGTAGGGCTTCCACTGG + Intergenic
1077458055 11:2692731-2692753 CCCAGAGGGAGGGATTTGATAGG - Intronic
1079812224 11:25008978-25009000 GCTTGAAGGTGGGATTTCACAGG + Intronic
1080819574 11:35792586-35792608 CCCAGAAGGAGGGATTTCACTGG - Intronic
1083518956 11:63288909-63288931 CCTAGAAGGAGGGATATCTGTGG + Intronic
1084599400 11:70136013-70136035 CCCAGAAGGAGGGAGGTCTGGGG - Intronic
1084864018 11:72041230-72041252 CCCAGAGGGAGGGGGTGCACTGG + Intronic
1085433477 11:76478137-76478159 CTGATAAGGGGGGATTTCACAGG - Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1089750234 11:120646430-120646452 CCCAGAAGGAGGCAGTACAAGGG - Intronic
1090547888 11:127785194-127785216 CCCAGATTGAGGGATTTTGCAGG + Intergenic
1090629524 11:128633843-128633865 CCCAGAAAGAGAGCTGTCACTGG - Intergenic
1091851127 12:3697883-3697905 CCCTGAAGGAGTGTTTTCAGAGG + Intronic
1093502443 12:19828056-19828078 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1095040649 12:37436570-37436592 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1096028978 12:48394793-48394815 CCCAGCAGGAAGGACCTCACTGG + Intergenic
1097271914 12:57780737-57780759 CCAAAAAGGATGGATTTCCCTGG + Exonic
1097456321 12:59802976-59802998 CACAGATGGAGGAATTTCAAAGG - Intergenic
1100716723 12:97313673-97313695 ACCAGAAGGAGGCATTTCAAGGG + Intergenic
1103483131 12:121264146-121264168 ACGGGAAGGAGGGAATTCACAGG - Intronic
1103941640 12:124504365-124504387 CTTATAAAGAGGGATTTCACAGG + Intronic
1104383300 12:128327105-128327127 CCCAGATGGAGTGATTTTAATGG + Intronic
1104510772 12:129375733-129375755 CCCAGAAGTATTGATTTCATTGG + Intronic
1107170962 13:37341610-37341632 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
1108689943 13:52850921-52850943 CCCAAAGGAAGGGATTTCAGCGG + Intergenic
1110810638 13:79807835-79807857 GCCTGAAGGAGGGGCTTCACTGG - Intergenic
1111202850 13:84962118-84962140 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1111779623 13:92705960-92705982 CCCAGTAGTTGGGATTACACAGG - Intronic
1111879858 13:93942706-93942728 CTCAAGAGGAGGGATTACACAGG + Intronic
1113020324 13:105877793-105877815 TGCAGAGGGAGGGATTTCATGGG - Intergenic
1113087034 13:106579349-106579371 GCCAGTTGGAGGGACTTCACTGG - Intergenic
1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG + Intronic
1116961878 14:50974924-50974946 CCCAGGAGGGGAGATTGCACTGG + Intergenic
1121192408 14:92041990-92042012 GCCAGGAGAAGGAATTTCACAGG + Exonic
1121479664 14:94254798-94254820 TCCAGGAGGAGGCATTTCAGAGG - Intronic
1121852978 14:97239592-97239614 CCCAGAATGATGGAATACACTGG - Intergenic
1121855296 14:97263784-97263806 CCCAGAAGAAGGGATTTTTATGG + Intergenic
1122034356 14:98936607-98936629 CCCAGAAGTAGGGGTTTGAATGG - Intergenic
1122354872 14:101116855-101116877 TCCAGGAGCAGGGAATTCACAGG + Intergenic
1123114793 14:105889817-105889839 CCCAGAAGGAGGGAGCACAGAGG + Intergenic
1123680198 15:22757666-22757688 GCCAGAAGGCGGGATTTCCGCGG - Intergenic
1123784929 15:23661933-23661955 CCCTGAAGGAGTGATTTGGCAGG + Intergenic
1124196727 15:27638142-27638164 CCCAGTAGCTGGGATTTCAGAGG - Intergenic
1124332417 15:28832132-28832154 GCCAGAAGGCGGGATTTCCGCGG - Intergenic
1124436263 15:29651920-29651942 GCCAGAAGGTGGGGCTTCACTGG - Intergenic
1124649928 15:31467063-31467085 CTCAGAAGCAGCGATTGCACAGG - Intergenic
1127211260 15:56777139-56777161 TCCAGAATGAGGGTTTTCAAGGG - Intronic
1128841275 15:70853598-70853620 TCCAGGAGGAGGACTTTCACGGG - Intronic
1130832682 15:87617320-87617342 CCCAGAAGGAAAGATTTCTATGG + Intergenic
1132423826 15:101697128-101697150 ACCAGAAGCAGGCATTTCAAGGG - Intronic
1132654571 16:1036501-1036523 CCCTGAAGGAGGGGTTCCCCGGG + Intergenic
1132898493 16:2240165-2240187 CCCTGAAAGTGGGATTTCAGTGG - Intronic
1133964848 16:10523251-10523273 CACAGAAGGAGGGATAGCACAGG + Intergenic
1135771353 16:25220683-25220705 ACCACAAGTAGGGTTTTCACTGG + Intronic
1139077688 16:63473368-63473390 CTCAGAAGGAGTGAATTCAATGG - Intergenic
1139625848 16:68187875-68187897 CCCTGAAGGTGGGGCTTCACTGG + Intronic
1140616452 16:76670492-76670514 CCCTGTAGGAGGGATTGCAGGGG - Intergenic
1141798603 16:86291772-86291794 CCCTGGAGCAAGGATTTCACAGG - Intergenic
1143223399 17:5281114-5281136 CCCAGGATGAGGGAGTCCACAGG - Intergenic
1146133353 17:30297137-30297159 GCTTGAAGGTGGGATTTCACCGG - Intergenic
1146549523 17:33768611-33768633 GCCTGAAGGTGGGGTTTCACTGG - Intronic
1147627663 17:41910340-41910362 GGCAGAAGGAGGGACTGCACAGG + Intronic
1153680926 18:7500406-7500428 CCCAGTAGGTGGGATTACAGAGG + Intergenic
1155321949 18:24628223-24628245 ACAAGAAGGAGGGATTTCCAAGG + Intergenic
1155955622 18:31954468-31954490 CCCAGCAAGAGGTATTTCCCTGG + Intergenic
1156517053 18:37688906-37688928 CCAATAAGGAGGGACTTCAGTGG + Intergenic
1157367049 18:47074833-47074855 CTCAGAAGAAAGGATTTCAGGGG - Intronic
1157699216 18:49749867-49749889 CCCACAAAGAGACATTTCACTGG - Intergenic
1158513498 18:58111959-58111981 CCCAGTAGGATGGCTATCACTGG - Intronic
1159510914 18:69397416-69397438 CTAAGAAGGAGGAATTACACAGG + Intergenic
1159766909 18:72502536-72502558 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1161213296 19:3079602-3079624 CCCAGAAGGAGGGGTTTAGAAGG + Intergenic
1161287187 19:3474741-3474763 CCCAGATGGAGTCATTTCACGGG + Exonic
1161666529 19:5580341-5580363 CCCAGCAGGGTGGATCTCACAGG - Intergenic
1161819703 19:6522331-6522353 CCTTGAGGGAGGGATTGCACAGG - Intergenic
1162247965 19:9418571-9418593 CCCAGAAGAATGGACTTTACTGG - Exonic
1162574491 19:11491101-11491123 CCCAAAAGAAGGGACTGCACTGG - Intronic
1162790341 19:13059503-13059525 CCTGGAAGGAGGGATTTGCCTGG - Intronic
1163153730 19:15429088-15429110 CCCAGGAGGTGGGGCTTCACCGG + Intronic
1163369737 19:16895285-16895307 CCCAGAAGCTGGGATTACAGGGG - Intronic
1165598938 19:37036484-37036506 GCCAGCAGGAAGGATCTCACAGG + Intronic
925273151 2:2629613-2629635 CCCGGACGGAGGGATCACACCGG + Intergenic
925361111 2:3280949-3280971 ACCAGAAGGAGGGAGATCAAGGG - Intronic
927154240 2:20212565-20212587 CCCAGGAGGAGGGGCCTCACTGG + Intronic
927454269 2:23236053-23236075 CCCTGAGGGAGAGATTTCCCTGG + Intergenic
927515635 2:23670236-23670258 CCCAGGAGGAGGGATTGGCCTGG + Intronic
928319312 2:30270432-30270454 CCCACAGTTAGGGATTTCACTGG - Intronic
929413388 2:41722531-41722553 CTCAGAATGAGGGGTTTCCCTGG + Intergenic
930971196 2:57397653-57397675 GCCTGAAGGTGGGATTTCGCCGG + Intergenic
931795459 2:65704385-65704407 CCTAGATGGAAGGATTTTACTGG + Intergenic
933056764 2:77680005-77680027 GCTTGAAGGATGGATTTCACGGG + Intergenic
933073847 2:77897382-77897404 GCCAGGAGAAGGAATTTCACAGG - Intergenic
933775461 2:85768795-85768817 CCCAGAAGGGGAGGATTCACTGG - Intronic
935718892 2:105962074-105962096 CCCAGAAGGAGGGAGAGCTCTGG - Intergenic
939017659 2:136920643-136920665 GCTTGAAGGAGGGGTTTCACTGG + Intronic
939083486 2:137688491-137688513 GCCAGGAGAAGGAATTTCACAGG + Intergenic
939084967 2:137708113-137708135 GCTTGAAGGTGGGATTTCACAGG + Intergenic
939599632 2:144173259-144173281 CTCAAAGGGAGGGATTACACAGG - Intronic
940422836 2:153499476-153499498 GCTTGAAGGTGGGATTTCACTGG + Intergenic
940569864 2:155417352-155417374 ACTTGAAGGTGGGATTTCACTGG + Intergenic
942844487 2:180406332-180406354 CCGAGAAAGAAGAATTTCACAGG + Intergenic
945560260 2:211330621-211330643 CCTTGAAGGTGGTATTTCACTGG + Intergenic
947332863 2:229048375-229048397 CCCAGGAGGAGGGAATCCTCTGG + Intronic
948920138 2:241062418-241062440 CCCAGATGGACTGGTTTCACAGG + Intronic
1168902050 20:1373272-1373294 CACAGAAGGAGTGGTTTCATAGG + Intronic
1168966082 20:1898871-1898893 CCCAGATGGGGGGCTCTCACAGG - Intronic
1170285231 20:14700852-14700874 CCAAGAAGGAGAGATTACTCTGG - Intronic
1171572663 20:26268716-26268738 GCCAGCAGGAGGGATTTCACAGG + Intergenic
1171805852 20:29679710-29679732 GCCAGCAGGAAGGATTTCACAGG + Intergenic
1171838211 20:30176725-30176747 GCCAGCAGGAAGGATTTCACAGG - Intergenic
1172831808 20:37842318-37842340 ACCTGAAAGAGAGATTTCACAGG - Exonic
1175182775 20:57160367-57160389 CCCAGCAGGCTGGATGTCACTGG + Intergenic
1175306400 20:57978705-57978727 AGCAGAAGGAGGGAAATCACAGG - Intergenic
1180574597 22:16760773-16760795 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1182060848 22:27396106-27396128 CCCAAACTGAGGGATCTCACTGG + Intergenic
1182486634 22:30643088-30643110 CCAAGAAGGAGGGAAGTCGCTGG - Intronic
1182831957 22:33311298-33311320 GCCAGAAGGATGGATCCCACTGG + Intronic
1182833859 22:33325707-33325729 ATCAGAAGGAGGGGTGTCACAGG - Intronic
950576688 3:13836439-13836461 CCCAGAGGTTAGGATTTCACTGG + Intronic
951509658 3:23486929-23486951 GCTTGAAGGTGGGATTTCACTGG + Intronic
954746852 3:52792269-52792291 CCCAGAAGCTGTGATTTCAGGGG + Intergenic
954903939 3:54043811-54043833 CCCAGAAGGGGGCATTTGAATGG + Intergenic
955187863 3:56732306-56732328 TCCAGCAGGAGGTCTTTCACGGG + Exonic
955397065 3:58565114-58565136 GCCAGAGGCAGGGATTTCAGGGG + Intronic
955638342 3:61054787-61054809 CATAGAAGGAGGGTTTTGACTGG - Intronic
955732639 3:62003412-62003434 CTGAGAAGGTGGAATTTCACTGG + Exonic
956401372 3:68883464-68883486 CATAGATGAAGGGATTTCACAGG - Intronic
956966536 3:74468095-74468117 CCAATAAGAATGGATTTCACAGG + Intronic
957486689 3:80870972-80870994 GCCTGATGGTGGGATTTCACTGG - Intergenic
958195297 3:90235660-90235682 GCCTGAAGGTGGGACTTCACAGG - Intergenic
958418706 3:93907067-93907089 GCCTGAAGGTGGGACTTCACAGG - Intronic
958833889 3:99121050-99121072 CCCAGAAGTAGCGATCTCTCTGG - Intergenic
959037461 3:101383858-101383880 GCCTGAAGGAGGGGCTTCACTGG - Intronic
959897073 3:111617259-111617281 GCCTGAAGGTGGGGTTTCACTGG - Intronic
959926974 3:111933180-111933202 CCCAGAAGGAAGCAGTTTACTGG - Intronic
960310521 3:116111028-116111050 GCCAGAAGAAGGAAATTCACAGG + Intronic
961548401 3:127652265-127652287 CCCAGACTCAGGGATTTTACAGG - Intronic
964494698 3:157275738-157275760 CCCAGAAGCAGTGTTTTCAAGGG - Intronic
965367760 3:167820777-167820799 GCCTGAAGGTGGGGTTTCACTGG - Intronic
965765211 3:172123296-172123318 CCCAAAATGTGGGATTACACAGG + Intronic
965945203 3:174232269-174232291 GCCAGGAGAAGGAATTTCACAGG + Intronic
966208085 3:177425024-177425046 CCCAGAAAGAGAAATTTCTCTGG - Intergenic
969593677 4:8136188-8136210 CCCAGAAGGACAAATATCACAGG + Intronic
969665401 4:8554412-8554434 CCAGGAGGGAGGGATTTTACAGG + Intergenic
970553577 4:17208917-17208939 ACCAGAAGGAGAAATGTCACAGG - Intergenic
971980821 4:33747683-33747705 GCCAGAAGAAGGACTTTCACAGG + Intergenic
973606636 4:52593602-52593624 CCCAGAAGGAGGGCAGGCACAGG - Exonic
974615191 4:64271465-64271487 GCCAGAAGGTGGGGTTTCACGGG - Intergenic
978061445 4:104344914-104344936 GCCTGAAGGTGGGGTTTCACTGG - Intergenic
978659209 4:111103609-111103631 CACAGAAGGTGGGATTACAGGGG - Intergenic
982343574 4:154331548-154331570 AGCAGATGGAGGGTTTTCACAGG - Intronic
983125885 4:163950107-163950129 GCCTGAAGGTGGGGTTTCACTGG + Intronic
984459674 4:180017902-180017924 CCCAGAAGCTGGGATTACAGAGG + Intergenic
984895017 4:184530697-184530719 GCAAGAGGGAGGGATTTCAAAGG - Intergenic
984898475 4:184563380-184563402 GCCAGCAGGAAGGATCTCACAGG + Intergenic
985496241 5:208123-208145 CCCAGAAGCAGGAGTCTCACCGG - Intronic
986417618 5:7544790-7544812 TCCAGGAGGAGGGACTTCCCTGG - Intronic
987427864 5:17794175-17794197 CCCAGAAAGCAGGATTTGACTGG + Intergenic
987613854 5:20247006-20247028 CCCAGAAAGAAGGATATCAGGGG - Intronic
988395319 5:30690636-30690658 GACAGAAGGAAGGCTTTCACTGG - Intergenic
989468484 5:41786085-41786107 CCCAGGAAGAGGGACTCCACCGG + Intronic
989821667 5:45800509-45800531 GCTTGAAGGAGGGGTTTCACTGG - Intergenic
990886695 5:60602442-60602464 CTCAGAAGGAGGCAGTTCACTGG + Intronic
990947248 5:61262189-61262211 CGCTGAAGGAGGGGTTTAACTGG - Intergenic
991734470 5:69619258-69619280 CCCAGAATGAAGAGTTTCACTGG - Intergenic
991780508 5:70127463-70127485 CCCAGAATGAAGAGTTTCACTGG + Intergenic
991810904 5:70474399-70474421 CCCAGAATGAAGAGTTTCACTGG - Intergenic
991859796 5:71002882-71002904 CCCAGAATGAAGAGTTTCACTGG + Intronic
991872956 5:71127780-71127802 CCCAGAATGAAGAGTTTCACTGG + Intergenic
993384849 5:87251815-87251837 GCCTGAAGGTGGGACTTCACGGG + Intergenic
994947045 5:106408713-106408735 CACAGAAAGAGGAACTTCACAGG - Intergenic
996581699 5:125038571-125038593 CACAGGAAAAGGGATTTCACTGG - Intergenic
998480556 5:142459329-142459351 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG + Exonic
1000353498 5:160371279-160371301 CCCAGAAGGTGAGGATTCACTGG + Intergenic
1000761010 5:165224467-165224489 CTCAGGAGGAGGGATGTAACAGG + Intergenic
1001253921 5:170169340-170169362 TCCAGAAGGATGGAGTTCAAAGG + Intergenic
1002316297 5:178346357-178346379 CCCAGTAGCTGGGATTTCAGGGG + Intronic
1003099607 6:3167175-3167197 GCCAGGAGAAGGAATTTCACAGG - Intergenic
1003251091 6:4429743-4429765 CCCAGGAGGAGGGCGTACACTGG - Intergenic
1004768068 6:18754061-18754083 CCCACAAGAAGGTATTTCACTGG - Intergenic
1005328794 6:24729024-24729046 CCAAGAAAGAGGGCTTTAACTGG - Intergenic
1007017015 6:38479121-38479143 CACAGGAGGAGAGATTTCCCTGG + Intronic
1008330665 6:50240775-50240797 GCCTGAAGGTGGGATTTCACTGG + Intergenic
1010462149 6:76125835-76125857 CCCAGAAGCAGGCACTTCAAGGG - Intergenic
1010687685 6:78871474-78871496 CCCAGTAGGAGGTATTCCACAGG + Intronic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1013437481 6:110125371-110125393 ACCAAAAGGAGGTAGTTCACAGG - Intronic
1014239700 6:119001833-119001855 CCCACAAGGACAGATTTTACTGG - Intronic
1014654072 6:124077427-124077449 CTCAGAAGGAGCAACTTCACTGG + Intronic
1018363924 6:163099241-163099263 GCTAGCAGGAGGGATGTCACTGG - Intronic
1018788865 6:167130997-167131019 CCCAGAAGGAGGGGTCCCAAAGG - Intronic
1020393129 7:7682374-7682396 CCCAGAATGAGGAATTCCATAGG - Intronic
1023649859 7:42357989-42358011 CCCAGAAGGAATGGATTCACTGG - Intergenic
1024009700 7:45257213-45257235 TCCAGAAGGAAGGGTTGCACGGG - Intergenic
1025286700 7:57668204-57668226 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1025299366 7:57805818-57805840 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1025920179 7:65904328-65904350 CCGAGTAGGTGGGATTTCAGGGG + Intronic
1027710825 7:81599469-81599491 CCCAGTAGCTGGGATTACACAGG + Intergenic
1030330918 7:108269499-108269521 CGCAGAAGGAAGGGTCTCACTGG + Intronic
1031837037 7:126691014-126691036 GCCTGAAGGCGGGGTTTCACCGG + Intronic
1033053094 7:138024428-138024450 CTGAGAAGGAGGGATATCATTGG + Intronic
1033130322 7:138740391-138740413 CCCAGAAGAATGGATGTCAATGG + Intronic
1033675497 7:143537465-143537487 GCCAGAAGAAGGAAATTCACAGG + Intergenic
1034690949 7:153013251-153013273 CGCAGGAGGAGGCACTTCACAGG - Intergenic
1036048122 8:5166688-5166710 CCCAGAAGGAATGAGTTGACAGG - Intergenic
1039386789 8:37143175-37143197 CCCAGGATGAGGGATGCCACTGG + Intergenic
1040475080 8:47768891-47768913 CCAAGTAGCTGGGATTTCACAGG - Intergenic
1040571458 8:48615119-48615141 GGCAGAAGGAAGGAATTCACAGG - Intergenic
1040917433 8:52577631-52577653 CCCAGAAGGAGGAATTTGATGGG - Intergenic
1041965479 8:63670194-63670216 GCCTGAAGGTGGGGTTTCACTGG + Intergenic
1042490335 8:69390631-69390653 TCAAGAAGGAGGGACTTAACTGG - Intergenic
1042643095 8:70956516-70956538 GTCTGAAGGAGAGATTTCACTGG + Intergenic
1042845285 8:73163741-73163763 CACACAAGAAAGGATTTCACAGG + Intergenic
1051996178 9:23220257-23220279 CCTTGGAGGTGGGATTTCACTGG + Intergenic
1052552562 9:29969872-29969894 GCCTGAAGGTGGGGTTTCACCGG + Intergenic
1053121197 9:35548401-35548423 GCCAGCAGGAGGCATCTCACTGG - Exonic
1053794212 9:41710209-41710231 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1054182618 9:61922248-61922270 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1054470739 9:65535730-65535752 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1054655889 9:67666231-67666253 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1056449707 9:86705010-86705032 CCCAGAGGGAAGGAAGTCACAGG - Intergenic
1057950047 9:99362579-99362601 GCCAGAAGAAGGGATTTGGCTGG - Intergenic
1058087225 9:100761532-100761554 GCAAGAAGGAGGGTCTTCACAGG + Intergenic
1061377443 9:130234798-130234820 CCCAGAAGGAGTCCTTGCACAGG + Exonic
1061918207 9:133768274-133768296 CCCAGAAGGTTGGCATTCACAGG - Intronic
1185757685 X:2664912-2664934 CCCAGAGGGAAGGCCTTCACTGG + Intergenic
1186459837 X:9739543-9739565 CCCGGAAGCAGGGTTTTCATGGG + Exonic
1186605142 X:11081665-11081687 CACAGAAGATGGGATTTCAGAGG + Intergenic
1188190910 X:27170587-27170609 CCCAGAAGGAGAGAATTGACGGG + Intergenic
1188203018 X:27316426-27316448 ACCAGAAAGAGGGATGTTACTGG + Intergenic
1188493006 X:30755876-30755898 CCTAGGAGGATGGACTTCACTGG - Intergenic
1190535325 X:51421010-51421032 CCCAGTTGCGGGGATTTCACCGG + Intergenic
1190801160 X:53790116-53790138 CCAAGTAGCTGGGATTTCACAGG - Intergenic
1191595286 X:62936731-62936753 CCTTGCAGGTGGGATTTCACTGG + Intergenic
1192428569 X:71097473-71097495 CCCAGGAGGAGGGAGTGCAGTGG + Intronic
1192784502 X:74323325-74323347 CACAGAAGGTGGGCTTGCACTGG + Intergenic
1192804131 X:74494994-74495016 CACAGAAGGTGGGCTTGCACTGG - Intronic
1194015434 X:88613467-88613489 TCCAGAATGAGGGATGTAACAGG - Intergenic
1194308090 X:92273316-92273338 GCCAGAAGAAGGAAATTCACAGG + Intronic
1194656328 X:96578277-96578299 CCTTGAATGATGGATTTCACAGG + Intergenic
1196137286 X:112223693-112223715 CCCTGTAGGAGGGACTCCACTGG + Intergenic
1196991722 X:121336482-121336504 CCCAGACTGAGGGAGTTCCCAGG - Intergenic
1197679160 X:129363857-129363879 GCCAGAAGGAGGGATTTGGATGG - Intergenic
1199728867 X:150611134-150611156 CCTATAAGGAGGAATGTCACGGG - Intronic
1201265521 Y:12202986-12203008 CCCAGAAGGTAGGATCTCAGTGG - Intergenic
1201448334 Y:14082735-14082757 CCCAGAGGCAGGGAATTCTCTGG + Intergenic