ID: 1080819742

View in Genome Browser
Species Human (GRCh38)
Location 11:35793967-35793989
Sequence AAGCACTTACAATTAATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080819742_1080819745 25 Left 1080819742 11:35793967-35793989 CCATTTATTAATTGTAAGTGCTT 0: 1
1: 0
2: 1
3: 55
4: 400
Right 1080819745 11:35794015-35794037 CAGATATGGAAACTTTAAAGAGG 0: 1
1: 0
2: 1
3: 35
4: 323
1080819742_1080819743 11 Left 1080819742 11:35793967-35793989 CCATTTATTAATTGTAAGTGCTT 0: 1
1: 0
2: 1
3: 55
4: 400
Right 1080819743 11:35794001-35794023 TTATCCTCATTTTACAGATATGG 0: 13
1: 236
2: 1389
3: 4300
4: 9475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080819742 Original CRISPR AAGCACTTACAATTAATAAA TGG (reversed) Intronic
906138527 1:43518516-43518538 AAGCACAAATAATTAAAAAAAGG - Intergenic
906830781 1:49029328-49029350 AAACAATTAGAAATAATAAATGG + Intronic
906916172 1:50012892-50012914 AAGGATGTACAAATAATAAAAGG + Intronic
907998397 1:59656076-59656098 AAGCTCTTACAATTAATATTAGG - Intronic
908462947 1:64363851-64363873 AAGCACTTAGAATGAAAAAAGGG - Intergenic
908942209 1:69448906-69448928 AAGGGCATATAATTAATAAATGG + Intergenic
909246251 1:73288231-73288253 AAGTACTTACTATTAAACAAGGG - Intergenic
909854372 1:80509869-80509891 AAGCAGTAACAGATAATAAATGG - Intergenic
909963125 1:81872911-81872933 AAGCACTTACAATTTCTTACTGG + Intronic
910182491 1:84500979-84501001 AAGTACTAAGAATTTATAAAAGG + Intronic
910488022 1:87737480-87737502 AAGATCTCACAGTTAATAAATGG - Intergenic
910744608 1:90560011-90560033 AAGCTCCTACAGTTCATAAACGG + Intergenic
911272997 1:95826352-95826374 AAGCACTTTTACTTTATAAAGGG + Intergenic
911315807 1:96355399-96355421 ATGCACATATATTTAATAAAAGG + Intergenic
911823888 1:102456016-102456038 AAACACTTAAAATTAATTTAGGG + Intergenic
911846286 1:102755420-102755442 AAGCACTTTCAAATAATATTTGG + Intergenic
912023713 1:105139545-105139567 AAGAATTTACTAATAATAAAAGG - Intergenic
912487592 1:110041428-110041450 AGGGGCTTACTATTAATAAATGG - Intronic
912911522 1:113764280-113764302 CATCACTTCCAATTCATAAATGG + Exonic
913584844 1:120264503-120264525 AAGCACTTACAAATATTAATTGG - Intergenic
913623338 1:120633855-120633877 AAGCACTTACAAATATTAATTGG + Intergenic
914566843 1:148876359-148876381 AAGCACTTACAAATATTAATTGG - Intronic
914605977 1:149253882-149253904 AAGCACTTACAAATATTAATTGG + Intergenic
915782762 1:158571110-158571132 AAGCACAAACAAGTAATAAGAGG - Intergenic
915957222 1:160231578-160231600 AAGCACATACATTTATTATATGG + Intronic
916102371 1:161403728-161403750 AAACACTTAAAATTATTCAAGGG + Intergenic
916644240 1:166766562-166766584 AAACATTTACATTTTATAAAGGG - Intergenic
916927047 1:169533146-169533168 AAGGACTCATATTTAATAAATGG + Intronic
918274620 1:182941939-182941961 AAGCATTTACACTTAAAAAATGG + Intronic
918570963 1:185991619-185991641 TAGCAGTTAAAATGAATAAATGG - Intronic
918783977 1:188740831-188740853 AATAACTTACAATTAAAAATAGG - Intergenic
918793487 1:188860546-188860568 TATCACTTTCAATTAATGAACGG - Intergenic
918840825 1:189536494-189536516 TAGCACATAAAATTAATAACAGG + Intergenic
919100241 1:193087443-193087465 AAGAACTTTCAACTAATAAAGGG - Intronic
919227873 1:194731025-194731047 CAGCAAGTACAATTCATAAAGGG - Intergenic
920578750 1:207084836-207084858 AAGCCCTTTCAATGAATACATGG - Intronic
920971405 1:210746390-210746412 AAGGTCATACAATTACTAAATGG + Intronic
921516969 1:216105174-216105196 AAGCGCTAACCATTAAAAAATGG - Intronic
921810875 1:219512424-219512446 AAGAAGTTACAAATAAGAAAAGG + Intergenic
922120422 1:222661904-222661926 AATCACTTACAATTTATGCACGG - Intronic
923924676 1:238611219-238611241 CAGTACTAACAATTAAGAAATGG + Intergenic
924597251 1:245458037-245458059 AAGCACTCACAAATATTAACTGG - Intronic
1065500231 10:26373744-26373766 TAGGAATTACAATTAGTAAAAGG - Intergenic
1066735047 10:38467543-38467565 AATAACTTACAATAAAGAAATGG - Intergenic
1067136688 10:43614615-43614637 AAGCACTGACAAAAAAGAAAGGG - Intronic
1067700141 10:48565579-48565601 AAACACTTAGAATTATTATAGGG + Intronic
1068087878 10:52397752-52397774 AAGCACTTACATGTTAAAAATGG + Intergenic
1068213068 10:53947084-53947106 AAACACTTAGAAATATTAAAAGG - Intronic
1068322679 10:55440270-55440292 AAACAATTAAAATAAATAAAAGG + Intronic
1068340662 10:55698118-55698140 ATGAAATTAAAATTAATAAAAGG + Intergenic
1068906704 10:62334202-62334224 AAGCAAATACAATCAAGAAAAGG - Intergenic
1069011046 10:63372746-63372768 AAGAACTTACAATCTATTAAGGG + Intronic
1070592357 10:77810196-77810218 AGGCACTTACAATCAAGGAAGGG + Intronic
1070714202 10:78707157-78707179 AAGCACTTTAAATTATTAATAGG + Intergenic
1071742326 10:88374154-88374176 AAGAAGTTACAATTGTTAAAAGG + Intronic
1074426905 10:113359274-113359296 CAGCACATACAAATAATACAGGG + Intergenic
1074482524 10:113838057-113838079 ATTCACTTCTAATTAATAAAAGG - Intronic
1076022782 10:127088199-127088221 ATGCACATCCAATTTATAAAAGG - Intronic
1077652777 11:3988993-3989015 AAGCATTTACACTTAAAAGATGG + Intronic
1077754461 11:5011219-5011241 TAGCACTTATAAATTATAAAGGG - Intergenic
1077777509 11:5287850-5287872 AAGCTCATGCATTTAATAAACGG + Intronic
1078278078 11:9870604-9870626 AGGGATTTCCAATTAATAAATGG + Intronic
1078956712 11:16205444-16205466 AAGCTCTTACTCTTATTAAAAGG - Intronic
1079353128 11:19709826-19709848 AAGCAAATAGAATTACTAAAGGG + Intronic
1079691220 11:23419783-23419805 AAACACTTAACATTAATAAATGG + Intergenic
1080476737 11:32601356-32601378 ATGCAATTAAGATTAATAAAAGG + Intronic
1080819742 11:35793967-35793989 AAGCACTTACAATTAATAAATGG - Intronic
1081189279 11:40082717-40082739 AAAGACTAATAATTAATAAATGG + Intergenic
1082963771 11:58944696-58944718 AAGCAATTATAATGAATAATGGG - Intronic
1083175622 11:60948313-60948335 ATTTACTTCCAATTAATAAATGG - Intronic
1085159025 11:74323991-74324013 AGACACTTACATTTAAAAAAGGG - Intergenic
1087182882 11:95156952-95156974 AAGAACTTACATTTAAAAGATGG + Intergenic
1087391603 11:97541957-97541979 AAGGACTCCCTATTAATAAATGG + Intergenic
1087956421 11:104293504-104293526 AAGCACTTCATATTAATCAAGGG - Intergenic
1088458273 11:110055598-110055620 AAGCACTGTTAATTAATAAATGG + Intergenic
1088829190 11:113520859-113520881 AAGCACTCACATTTACTGAAGGG - Intergenic
1088940985 11:114455714-114455736 AAATACTTAAAATTAATAAATGG + Intergenic
1090838087 11:130468066-130468088 ATGCACTAACAACAAATAAAGGG + Intronic
1091324297 11:134673264-134673286 GAACATTTACAAATAATAAAAGG + Intergenic
1093321190 12:17717759-17717781 AAGCATTTACAAGTAGTCAAAGG + Intergenic
1093684037 12:22036166-22036188 ATCCACTTTCACTTAATAAAAGG + Intergenic
1093877304 12:24364246-24364268 AAGCCCTTAAAATTAATAATAGG + Intergenic
1094182641 12:27608571-27608593 AAGCATTTACCCTTAAAAAATGG + Intronic
1095776165 12:46012351-46012373 AAGGTCTTACAACTAATTAAAGG + Intergenic
1095808506 12:46347049-46347071 AAGGATTTCCATTTAATAAATGG - Intergenic
1095920196 12:47521795-47521817 AAGGACTCCCTATTAATAAATGG - Intergenic
1096168097 12:49442230-49442252 AATCACTTACACTTAATAAATGG + Intronic
1097202372 12:57290177-57290199 AAGCACAGACAATTTATAATAGG - Intronic
1097306035 12:58070049-58070071 AAGCACTTAATCTTAACAAAAGG + Intergenic
1097603823 12:61728490-61728512 AAGCAACAACAATTAAAAAAAGG - Intronic
1098124856 12:67280107-67280129 AAGCACGTACTTTTAAAAAATGG - Intronic
1098451750 12:70626958-70626980 AAGAAAGTAAAATTAATAAATGG + Intronic
1098508061 12:71277990-71278012 TAGCACTTACATTTAAAATATGG + Intronic
1098585204 12:72146164-72146186 AGCCACTTACAACTAATAAATGG - Intronic
1098819998 12:75215110-75215132 ATTCGCTTACACTTAATAAATGG - Intergenic
1099083305 12:78213934-78213956 AAGCAGTTACAATTTATGGAGGG - Intergenic
1099537302 12:83859951-83859973 AAGCACTCACAATTAATCATGGG - Intergenic
1100070701 12:90712858-90712880 AAGCACTTAACATTCCTAAATGG - Intergenic
1100550198 12:95640033-95640055 AAAAATTTACAATAAATAAAAGG - Intergenic
1103746865 12:123130832-123130854 AAGCAATTACATTTATTACAGGG - Intronic
1104155869 12:126131451-126131473 AAGCACTCCCTATCAATAAATGG - Intergenic
1106346154 13:28880723-28880745 AATCCCTAACACTTAATAAAAGG - Intronic
1106445479 13:29826546-29826568 AAGCAATAAAAAATAATAAAGGG - Intronic
1106474532 13:30086951-30086973 AATCACTGACAAATAAGAAATGG + Intergenic
1107715029 13:43191605-43191627 AAGGAATTAAAATGAATAAATGG + Intergenic
1107864473 13:44690389-44690411 AAGCACTTCCACTTAGTAAGTGG - Intergenic
1108383554 13:49877246-49877268 ATTCATTTCCAATTAATAAATGG + Intergenic
1108384884 13:49890326-49890348 GAGTACTTACCATAAATAAATGG - Intergenic
1108387142 13:49909649-49909671 GAGTACTTACCATAAATAAATGG - Intergenic
1108544664 13:51480821-51480843 AAGATCTTACAATCAGTAAATGG - Intergenic
1108584304 13:51855526-51855548 AAATAACTACAATTAATAAATGG + Intergenic
1108737477 13:53299440-53299462 AAGCATGTAGAATTAATTAATGG - Intergenic
1108929375 13:55796660-55796682 AATCTCTTCCAAATAATAAAAGG - Intergenic
1109126809 13:58528351-58528373 GAGTACTTACCATAAATAAATGG - Intergenic
1109222519 13:59654799-59654821 ATGCATTTAAAATTAATTAAAGG + Intergenic
1109316762 13:60758335-60758357 AAGCAGCTACAATTGATAAGTGG - Intergenic
1110163404 13:72407353-72407375 AAAAATTTAAAATTAATAAAAGG - Intergenic
1110823205 13:79940733-79940755 AAGTATTTATAATTAATATATGG - Intergenic
1112067468 13:95809141-95809163 AAGCATTTACACTTAAAAAATGG + Intronic
1112290212 13:98139734-98139756 AAACAGTTAAAATTAATAAGAGG + Intergenic
1113005031 13:105691187-105691209 ACGTACATACAATAAATAAATGG - Intergenic
1113583212 13:111443618-111443640 AAAAACTTAAAATTTATAAAGGG - Intergenic
1114041977 14:18687317-18687339 ACTGAATTACAATTAATAAATGG + Intergenic
1114135131 14:19839321-19839343 AACAACTGACAATTAATATAAGG - Intergenic
1114854901 14:26427028-26427050 AAGTACTTACAACAAATAACAGG + Intergenic
1115630368 14:35238932-35238954 AATCACTTAATATTAATGAAAGG - Intronic
1116367766 14:44089482-44089504 AACCTATTACAATTAATAAACGG - Intergenic
1117036660 14:51737027-51737049 AAGGAGTTAAAAATAATAAATGG + Intergenic
1117204010 14:53422235-53422257 AAGCAATTAGAATAATTAAAGGG - Intergenic
1117637894 14:57765902-57765924 AAGCACTTACCATTGCTGAAAGG - Intronic
1118420808 14:65600482-65600504 AAGCGCTTACATTAAATAAGTGG + Intronic
1118625836 14:67658054-67658076 TAGCATTTTCACTTAATAAATGG + Intronic
1118762261 14:68887620-68887642 AAGCATTTACACTTAAAAAATGG + Intronic
1119078524 14:71669284-71669306 AAGTTCTATCAATTAATAAATGG + Intronic
1119344455 14:73911064-73911086 AACCAATTAGAATGAATAAAAGG + Intronic
1120329121 14:83066235-83066257 AAGCACTTAAAATTAAATATTGG - Intergenic
1120378134 14:83735457-83735479 CAGCACTGAGAATGAATAAAGGG - Intergenic
1120453140 14:84696660-84696682 ATCCACTTCCACTTAATAAATGG - Intergenic
1122177814 14:99934113-99934135 TACCAATTACAATTATTAAATGG - Intronic
1122256491 14:100481419-100481441 AAGCATTTACACTTAAAAAATGG - Intronic
1122680798 14:103460928-103460950 ACCCACTTATAATTAACAAAAGG - Intronic
1124357964 15:29011812-29011834 ATGCACTCAAAATTTATAAAGGG - Intronic
1124653877 15:31492642-31492664 AACCACTAACAATTAAAAATAGG + Intronic
1124660314 15:31544118-31544140 AAGCACTTACAATAATTCATGGG + Intronic
1125418944 15:39484040-39484062 AAGCTATTAGAACTAATAAATGG + Intergenic
1125565443 15:40674651-40674673 AAGCACTCAGATTTAAAAAAAGG - Intergenic
1126391151 15:48154075-48154097 AAACACTTCTCATTAATAAATGG - Intronic
1126822357 15:52517007-52517029 AAGCAGTTTCAATTTTTAAAAGG + Intronic
1127786677 15:62361863-62361885 AAGCATTTACACTTAAAAAATGG + Intergenic
1127851773 15:62919662-62919684 AAGCTCTTACAGCTAGTAAAAGG + Intergenic
1127990910 15:64116212-64116234 AACCACTTCCATTTAATGAAAGG - Intronic
1128101177 15:65001277-65001299 AAGCACTTATAATTACTCCAGGG - Intergenic
1128188366 15:65664813-65664835 AAGCACTAAAAATAAATTAAGGG + Intronic
1128413756 15:67424473-67424495 AAGAGCTTACAATTAATAGGAGG - Intronic
1128903587 15:71447799-71447821 ATGCACTTACAATTCATCACAGG + Intronic
1129421283 15:75428934-75428956 ATCCACTTCCACTTAATAAATGG + Intronic
1130031610 15:80319416-80319438 AAGCACATAAAAGTGATAAATGG + Intergenic
1130873908 15:87995525-87995547 AAGGAGTTCCTATTAATAAATGG + Intronic
1131419185 15:92289557-92289579 AATCACTTACAGTTAAGGAAGGG + Intergenic
1131473005 15:92712253-92712275 AAGCATTTACACTTAAAAAATGG - Intronic
1135232955 16:20726878-20726900 AAGGCCTTCCAAATAATAAAGGG - Intronic
1135462393 16:22656395-22656417 AAGCTCTAACAATTAAAACAAGG + Intergenic
1137751059 16:50861428-50861450 AAGCACCAAAAATTAATAATGGG - Intergenic
1137851764 16:51752605-51752627 AAGCAGTTACAATTGATGAGTGG - Intergenic
1138832135 16:60387278-60387300 AAGGATTTCCTATTAATAAATGG - Intergenic
1139033118 16:62909849-62909871 AAGAACTGACAAATGATAAAAGG - Intergenic
1139213553 16:65105264-65105286 AAGCACTGAGAATTAGGAAAAGG + Intronic
1139950897 16:70669137-70669159 TAGCACTAACAATTTAAAAATGG + Intronic
1140265086 16:73413521-73413543 AAGCTCCTACAATTAGCAAAAGG + Intergenic
1141366147 16:83445267-83445289 AAGCTTTTATAATTTATAAAAGG + Intronic
1143854770 17:9840491-9840513 AAGCACTTAAAAATAATGCATGG - Intronic
1147355213 17:39890303-39890325 ATGCACATACAGTTAATAGATGG - Intergenic
1147807975 17:43145718-43145740 AAGCATTTACACTTAAAAAATGG - Intergenic
1149939830 17:60851884-60851906 AAGCATTTACACTTAAAAAATGG - Intronic
1151281138 17:73074918-73074940 AAGCACTTATAAGGAATAATAGG - Intronic
1151429703 17:74053999-74054021 AAACACATAAAATAAATAAAGGG - Intergenic
1152309532 17:79541328-79541350 AAACACTCACACTAAATAAATGG + Intergenic
1153717554 18:7866033-7866055 AAGCAATAAAAAATAATAAACGG - Intronic
1155127959 18:22899069-22899091 AAGATCTTACAATTAGTACATGG + Intronic
1155132302 18:22950235-22950257 TAGCACTTACAATTCAGAAAAGG - Intronic
1155643525 18:28049201-28049223 AAGCACTTACAAGTGGCAAATGG + Intronic
1155790926 18:29969924-29969946 AAGCAGATACAAAAAATAAAGGG + Intergenic
1156575279 18:38307842-38307864 AAGCACTTAGAATATAGAAATGG - Intergenic
1156611233 18:38727065-38727087 AGGGATGTACAATTAATAAATGG + Intergenic
1156738952 18:40300601-40300623 AAGCTTTCACAATTAATAAACGG - Intergenic
1157171275 18:45408330-45408352 TAGCACCTACAATTAATGAGTGG + Intronic
1158339141 18:56446630-56446652 TATCACTTGCAATAAATAAAAGG + Intergenic
1158466643 18:57696453-57696475 AAGCCTTTACAATTAAGAAGTGG + Intronic
1159297448 18:66513527-66513549 AAACACATACCACTAATAAAGGG + Intronic
1159330565 18:66989329-66989351 CAGCAATTTCAATTAATTAAAGG - Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1164030192 19:21396847-21396869 AAGCACTTATAAATAATATATGG - Intergenic
1164032739 19:21423011-21423033 AAGGATTTACAGTTAAGAAAAGG + Exonic
1164045547 19:21536378-21536400 GAGAACTTACAATTAAGAAAAGG + Exonic
1164103985 19:22088075-22088097 GAGAATTTACAATTAAGAAAGGG + Exonic
1166437395 19:42779860-42779882 AAGCATTTTCAAATCATAAATGG - Intronic
926446894 2:12953688-12953710 AAGCATAAACAATAAATAAAAGG - Intergenic
926513767 2:13815261-13815283 AAGCAGTTAAAATTAATAGAAGG - Intergenic
926517762 2:13870718-13870740 AAATGCTTACAACTAATAAAGGG + Intergenic
927407460 2:22787657-22787679 AAAAGCTTACACTTAATAAAGGG - Intergenic
927569243 2:24144045-24144067 AAGCACTTACACATCATAAATGG - Intronic
928657622 2:33469171-33469193 TAGCATTTACAATTAACAACTGG - Intronic
928970896 2:37027794-37027816 GAGAACTTACAATAAATAAATGG + Intronic
930007510 2:46909864-46909886 AGTCACTTACAATTCATGAATGG + Intronic
932954258 2:76333042-76333064 AAGCACATACATTTTAGAAATGG + Intergenic
934169271 2:89325846-89325868 ATGTACTTACAATTAATATTTGG - Intergenic
934198022 2:89856738-89856760 ATGTACTTACAATTAATATTTGG + Intergenic
934867687 2:97827693-97827715 AAGCATTTACACTTAAAAAATGG - Intronic
935550831 2:104451930-104451952 AAGTTCATACAATTAGTAAATGG - Intergenic
936150058 2:110012351-110012373 AAGAATTTACAATTAATGAAAGG - Intergenic
936194617 2:110359019-110359041 AAGAATTTACAATTAATGAAAGG + Intergenic
937147347 2:119659083-119659105 AAGAAGTTACAATTAAGGAAAGG - Intronic
937749059 2:125452602-125452624 TAGCATTTACAATAAAAAAAAGG + Intergenic
938189183 2:129259378-129259400 AAGCACAGACAATTACTTAATGG + Intergenic
938268238 2:129945215-129945237 ACTGAATTACAATTAATAAATGG - Intergenic
939321772 2:140632442-140632464 AAACATTTACAATTAATCTAAGG - Intronic
939355484 2:141096283-141096305 GAGGATTTACAGTTAATAAAAGG - Intronic
939592709 2:144085183-144085205 AAGCATTTACAGAAAATAAATGG + Intronic
939657293 2:144843331-144843353 ATGCATTTAAAATTATTAAATGG + Intergenic
939887034 2:147692187-147692209 ATGCATTTACTATTACTAAATGG - Intergenic
940483000 2:154259626-154259648 AAGCAACTTCATTTAATAAATGG + Intronic
941469537 2:165867555-165867577 CAGCACATACATTTTATAAAAGG + Intronic
941613858 2:167696234-167696256 AAGGTCTCACAACTAATAAAAGG - Intergenic
941813426 2:169776961-169776983 AAACACACACATTTAATAAAAGG + Intronic
942259317 2:174141995-174142017 AAGCACCTAAAATGAATTAAAGG + Exonic
943907395 2:193517049-193517071 AAACAAAAACAATTAATAAATGG - Intergenic
943961387 2:194268352-194268374 AAGTTCTTTTAATTAATAAATGG + Intergenic
944360696 2:198852354-198852376 ATGCACTTACAATAAAAATAAGG + Intergenic
945215110 2:207425140-207425162 TATCCCTTATAATTAATAAATGG + Intergenic
945518264 2:210790244-210790266 AGGCACTTACAAAAAATACAGGG - Intergenic
945717176 2:213372323-213372345 AAGCATTTACAATTTCTAGAAGG - Intronic
946700233 2:222404859-222404881 AAGCTCTTCCAATTATTACAGGG - Intergenic
947318056 2:228885262-228885284 AAACAATTACAAATAATAAAAGG + Intronic
948682785 2:239647792-239647814 AAGCACTTAATATTAGTAATAGG - Intergenic
1168779226 20:474518-474540 AAGCAACTACTTTTAATAAATGG - Intronic
1168875046 20:1165602-1165624 GAGCAATGGCAATTAATAAACGG - Exonic
1169592057 20:7155399-7155421 CAGCACTTACAATTCAAACATGG - Intergenic
1169759519 20:9075909-9075931 AAGCACTTACAGCTAACAAAAGG - Intronic
1169980186 20:11376038-11376060 AAGCACTTTAAATTTAGAAAAGG + Intergenic
1170416154 20:16144729-16144751 AAGCTCTTACAACTAATCACTGG + Intergenic
1170853898 20:20030639-20030661 AAATATTTAGAATTAATAAAAGG + Intronic
1172382103 20:34503178-34503200 AAGCACTAACAATTTATATTGGG + Intronic
1173582521 20:44157668-44157690 AAGGACATACAACTAAGAAATGG + Intronic
1176666481 21:9692219-9692241 GAGCACTTACCATTGATTAAAGG + Intergenic
1177928358 21:27248260-27248282 ATCCACTTCCATTTAATAAATGG + Intergenic
1178516775 21:33254657-33254679 AAAAACTTGGAATTAATAAAAGG - Intronic
1179002138 21:37471520-37471542 CAGCTCTGGCAATTAATAAATGG - Intronic
1179213122 21:39342947-39342969 AAGCATTTACACTTAAAAAATGG + Exonic
1180582694 22:16856023-16856045 AAGAATTTACAATTAATGAAAGG + Intergenic
1181894143 22:26092290-26092312 AAGGTCATACAATTATTAAATGG + Intergenic
949149928 3:754197-754219 AAGCTCTTAGATTTGATAAATGG - Intergenic
949166091 3:942969-942991 AAGGACTTCCTATGAATAAATGG + Intergenic
950340403 3:12239005-12239027 AAGCATTTCCAATCAATACATGG + Intergenic
950939278 3:16876998-16877020 AAGTAGTTAAAAATAATAAAGGG - Intronic
951228141 3:20144639-20144661 ATGGACTTAAAATAAATAAATGG + Intronic
951364612 3:21765925-21765947 AATCCCTTCCAATTAATTAAAGG - Intronic
952285839 3:31969243-31969265 CAGCACTTACAAATAATCACAGG + Intronic
953506780 3:43493490-43493512 AAATACTTTCAATAAATAAATGG - Intronic
953953440 3:47211521-47211543 AAGAACTTAAAATTATAAAAGGG + Intergenic
954953579 3:54496663-54496685 AGGCACTTACATTTTAAAAATGG - Intronic
956807475 3:72830017-72830039 AAGGAATTACAAATAAGAAATGG + Intronic
956833176 3:73073383-73073405 ATGCACTTTCAATTACTAACTGG + Intergenic
957250090 3:77761435-77761457 AAGGATTTGCTATTAATAAATGG + Intergenic
957880593 3:86207103-86207125 TATCACTTATAATTAATTAATGG - Intergenic
958669423 3:97184188-97184210 AAGCAATGACAACTAATACAAGG + Intronic
959943318 3:112102348-112102370 AATCATTTACATTTTATAAATGG - Intronic
960894144 3:122483734-122483756 AAGCATTTACACTTAAAAAATGG - Intronic
962561334 3:136609743-136609765 AAGCATTTACACTTTAAAAATGG - Intronic
962693548 3:137925586-137925608 AAACACTTCCAATTAAAAATGGG + Intergenic
963152659 3:142062105-142062127 AACCACTTACACTTAATGAATGG + Intronic
964244782 3:154638771-154638793 AAGGACTCCCTATTAATAAATGG + Intergenic
964308340 3:155364210-155364232 ACGCACGTACAATTAAAAAGAGG - Intergenic
964352639 3:155817946-155817968 AAGCAATTATATTCAATAAAAGG + Intergenic
964604039 3:158539808-158539830 AAGTACTTACACATAATAGAAGG - Intronic
964786717 3:160403561-160403583 AAGCACTTTGTATTAAAAAAAGG - Intronic
964944653 3:162205428-162205450 AAGCAATTTCAACAAATAAAGGG + Intergenic
965357474 3:167694167-167694189 AAGCATTTACACTTAAAAAATGG + Intronic
965870701 3:173261092-173261114 AAGGACTGAAAACTAATAAAAGG - Intergenic
966047075 3:175565302-175565324 AAGGACTTACCATTTACAAATGG - Intronic
966065167 3:175812650-175812672 AGGCACTTACAAGGATTAAAAGG - Intergenic
966507014 3:180715891-180715913 AAGCATCTAAAAATAATAAATGG + Intronic
967395998 3:189009660-189009682 AAGAACTTTGCATTAATAAATGG - Intronic
967442343 3:189523461-189523483 AACCTCTTAGATTTAATAAATGG + Intergenic
967766547 3:193286420-193286442 GAGCACATACTATTAAAAAATGG - Intronic
968380029 4:85829-85851 GAGAATTTACAATTAAGAAAAGG + Exonic
968397308 4:253658-253680 AAGAATTTACAATTAAGGAAAGG + Intergenic
968886162 4:3334057-3334079 AAGCATTTACAATTTTTAAAAGG - Intronic
970815438 4:20150710-20150732 AAGCATTTACAATTAATGCAAGG + Intergenic
971412334 4:26387421-26387443 AGTCATTTATAATTAATAAATGG + Intronic
971946704 4:33287625-33287647 AAGTACATACAATTTACAAAAGG - Intergenic
973538292 4:51906903-51906925 AAGGAGTTAAAATCAATAAATGG - Intronic
976961137 4:90975983-90976005 AAGGTCACACAATTAATAAAAGG - Intronic
977003235 4:91530445-91530467 AAACATTAACAATGAATAAATGG + Intronic
977852951 4:101852153-101852175 AAGCACTAGAAATTGATAAATGG - Intronic
978358443 4:107902737-107902759 AAACATTTACAATTAAGAAGAGG - Intronic
979229685 4:118333490-118333512 TAGCACTTACAATTTGTTAATGG + Intronic
979348175 4:119613708-119613730 AACCCCCTAGAATTAATAAAGGG - Intronic
980335331 4:131466157-131466179 AAATACATATAATTAATAAAAGG - Intergenic
980599673 4:135005449-135005471 AATCACTTACATGTAAAAAATGG + Intergenic
980732071 4:136836408-136836430 AAGCTCCTTCTATTAATAAAAGG - Intergenic
980873971 4:138641953-138641975 AAGCACTAACAAAGAATGAAGGG - Intergenic
981010740 4:139922309-139922331 AAGCACTCATATTTAAAAAATGG + Intronic
982461903 4:155680735-155680757 ACCCACTTGCACTTAATAAATGG - Intronic
982549792 4:156783480-156783502 AAGCAGTTATTATTAACAAAGGG - Intronic
983539748 4:168896692-168896714 TAGCATTTATAATTAATATATGG - Intronic
984976815 4:185238249-185238271 AAGGACCTACCATTAGTAAATGG + Intronic
985408546 4:189660122-189660144 GAGCACTTACCATTGATTAAAGG - Intergenic
986815849 5:11409961-11409983 AAGGAGTAACATTTAATAAATGG - Intronic
987546701 5:19319823-19319845 AAGCAAATACAATCTATAAAAGG - Intergenic
987586217 5:19860116-19860138 AATCACTTAAAATTATTCAATGG - Intronic
988366036 5:30301137-30301159 AAACACTTAAAAATATTAAATGG - Intergenic
988637158 5:32996827-32996849 AAACACATAGAATTACTAAAGGG - Intergenic
990152220 5:52831891-52831913 AAGCTCTTAAAATTCTTAAAAGG - Intronic
990672281 5:58146052-58146074 AATCACTTACAGTGAGTAAAAGG + Intergenic
991908575 5:71537377-71537399 AAGCATGTACACTTAAAAAATGG + Intronic
992252588 5:74890141-74890163 AGGCAAATACAATTAATTAATGG - Intergenic
993358042 5:86939200-86939222 ATGCAATTAAAAATAATAAAGGG - Intergenic
993688763 5:90972994-90973016 ATGCAATAAAAATTAATAAAGGG + Intronic
993815464 5:92539261-92539283 AATTTCTTATAATTAATAAAAGG - Intergenic
993847139 5:92958011-92958033 TAGCTATTACTATTAATAAAAGG - Intergenic
994039606 5:95244111-95244133 AACCTATTACATTTAATAAAGGG - Intronic
994904410 5:105818585-105818607 AAGCACTTAACTTTAATATAAGG + Intergenic
995362406 5:111312328-111312350 AAGGTCATACAATTAATAAGAGG - Intronic
995441848 5:112200967-112200989 AAGGACTTAAATTTAATAATAGG - Intronic
995446728 5:112252910-112252932 AAATACTGACAATAAATAAAAGG + Intronic
996076896 5:119206313-119206335 AAGCACATACACTTCTTAAAAGG - Intronic
996081028 5:119258184-119258206 AAGGACTTCCCATCAATAAATGG + Intergenic
996443512 5:123517829-123517851 AATATATTACAATTAATAAATGG - Intronic
996793846 5:127322475-127322497 AAGCACTTACAACCAGTGAATGG - Intronic
996801943 5:127414074-127414096 AAGTCCTTACATTTGATAAAGGG - Intronic
996914007 5:128690022-128690044 CAGCACTTAAAATTGACAAAAGG - Intronic
997849604 5:137319462-137319484 AACCATTTACAAGTATTAAAAGG - Intronic
997992186 5:138553701-138553723 AAGTACTTACAATCACTAAAGGG + Intergenic
998088072 5:139342676-139342698 AAGCACAGAAAATTATTAAAAGG - Exonic
999025156 5:148221192-148221214 AAGCACTTACACTTAAGTAATGG + Intergenic
1000774639 5:165403720-165403742 AAGAACTTAAAATTATAAAACGG + Intergenic
1000781414 5:165487213-165487235 CAGCACTTACAATAAATTATTGG - Intergenic
1000783876 5:165519299-165519321 AAGCAATAAAAATAAATAAAAGG - Intergenic
1001800202 5:174536929-174536951 AAACTCCTAGAATTAATAAATGG + Intergenic
1003241419 6:4348870-4348892 AAGCCCTAACAATATATAAACGG - Intergenic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1005710610 6:28500685-28500707 AAGACCTTAAAATTCATAAATGG - Intergenic
1005915122 6:30344981-30345003 AAGCACTGAAAATTCATAAAGGG + Intronic
1006324765 6:33345444-33345466 AAGCACTTTCAATAAATACTTGG + Intergenic
1006967226 6:38000248-38000270 AAGAATTTATAATTAATTAATGG - Intronic
1007288233 6:40763532-40763554 AAGTCCATACAATTAGTAAATGG - Intergenic
1007889576 6:45274128-45274150 AAGACATTACAATTAAAAAATGG - Intronic
1008086632 6:47252442-47252464 AAGTACATACAATTAAAGAAAGG + Intronic
1008098688 6:47368230-47368252 AAACTCTTTCAATAAATAAAAGG + Intergenic
1008810180 6:55487224-55487246 AAGCAATAAAAATAAATAAAAGG - Intronic
1009564845 6:65300653-65300675 AACCACTCACAATGAATACATGG - Intronic
1009669782 6:66731975-66731997 AAACACTCTAAATTAATAAAAGG - Intergenic
1012631823 6:101479720-101479742 AAGCACTAACCTTTAACAAATGG - Intronic
1014288106 6:119526287-119526309 ATTTACTTTCAATTAATAAATGG + Intergenic
1014437288 6:121435131-121435153 AAGCAAGGACAATTAACAAAGGG - Intergenic
1015679546 6:135790057-135790079 AAGCATTAACAATTGATAAATGG - Intergenic
1016173549 6:141050183-141050205 AAGAACATCCAATTAAGAAATGG - Intergenic
1017286418 6:152681599-152681621 ATGAACTTACAACTAAAAAAAGG + Intergenic
1017833596 6:158155480-158155502 AATCAGTTGCTATTAATAAATGG + Intronic
1018234389 6:161709689-161709711 AATCAAATACAATAAATAAAGGG - Intronic
1018404476 6:163464015-163464037 AAGCACATACAAATAGCAAAAGG - Intronic
1018420456 6:163636405-163636427 AAATAATTACAATTAACAAAAGG - Intergenic
1020494571 7:8833114-8833136 AAGCTCATACAATTAGTAAGTGG - Intergenic
1021072048 7:16252953-16252975 AAGCAATTAAAAATGATAAAGGG - Intronic
1022736000 7:33076699-33076721 AAGCAATTTCTATTAACAAAAGG - Intergenic
1023002428 7:35824008-35824030 AAGCACTTAAAAAAAAAAAAAGG - Intronic
1024156887 7:46635088-46635110 AAGCATTTACACTTAAAAAGTGG - Intergenic
1024837059 7:53533780-53533802 AATCACTTAAAATTATTCAATGG - Intergenic
1025805696 7:64831549-64831571 AAGAATTTACAGTTAAGAAAAGG + Exonic
1025817387 7:64927752-64927774 GAGAATTTACAATTAAGAAAAGG + Exonic
1026039007 7:66850827-66850849 AAGCACTGACATTTATAAAATGG - Intergenic
1027449577 7:78315408-78315430 CAGCACTTATAAGAAATAAAAGG - Intronic
1027649595 7:80849888-80849910 AAGCACATATAATCTATAAAGGG + Intronic
1028059672 7:86296306-86296328 AAGAGCTTACAATTTATAATTGG - Intergenic
1028283628 7:88966718-88966740 AGTCATTTACAAATAATAAAAGG + Intronic
1028384050 7:90233678-90233700 AAGGTCTTGCAGTTAATAAATGG + Exonic
1028485335 7:91351210-91351232 AAGCATTTAGCATTAATGAATGG - Intergenic
1028593405 7:92522955-92522977 GAGCCCTTACAATTATTAAGAGG - Intronic
1028956567 7:96700092-96700114 AAGCACTTAGTACTGATAAATGG + Intronic
1029412652 7:100425431-100425453 AAGAACTTAGAAATAATAAAGGG + Intronic
1030972662 7:116079448-116079470 AAGCTCCTAGAACTAATAAATGG + Intronic
1031378058 7:121051349-121051371 AGGCATTTACATTTAAAAAATGG - Intronic
1031409639 7:121426030-121426052 AAGCACTAACCATTCAGAAACGG + Intergenic
1032469727 7:132169636-132169658 AAGCAGATAAAATTAATCAATGG + Intronic
1032994543 7:137430795-137430817 AAGCACTTCCATTTGATAACAGG + Intronic
1033077814 7:138266027-138266049 AAAAAGTTACAATTAATAAGAGG - Intergenic
1033103341 7:138496657-138496679 AAGAAAATACAATTAAAAAAAGG - Intronic
1033487657 7:141806690-141806712 AAGCCATTAAAAGTAATAAATGG + Intergenic
1035866346 8:3086998-3087020 AAGCACTAACTAAGAATAAAAGG - Intronic
1036128263 8:6083782-6083804 AAACGCTGACAATCAATAAATGG + Intergenic
1036277487 8:7368303-7368325 AAGTACTTATGATTAAAAAAAGG - Intronic
1038081950 8:24148158-24148180 AATAAATTACAATTAATAATAGG - Intergenic
1039310277 8:36310638-36310660 GAGCACTTACAAATAAGAAAAGG + Intergenic
1039382474 8:37099279-37099301 AAGCACTTACAAATGTTAACAGG + Intergenic
1039688343 8:39834092-39834114 AAACACATTCATTTAATAAAAGG + Intronic
1040711399 8:50193543-50193565 AAGCTCCTAGAATTGATAAAAGG - Intronic
1041284659 8:56247494-56247516 AAGTTCTTACATTTAGTAAATGG - Intergenic
1042026343 8:64428047-64428069 AAGGACGTGCAGTTAATAAAAGG - Intergenic
1043912542 8:85879706-85879728 AAGCACTTGGAATTACAAAAGGG - Intergenic
1045436181 8:102167095-102167117 AATCACTTAAAATTCAAAAAAGG + Intergenic
1045580811 8:103477790-103477812 AAGCACTAAGAATAAATAAAGGG + Intergenic
1045655343 8:104381380-104381402 AAGCTCTCGCAATTCATAAAGGG - Intronic
1045788027 8:105945825-105945847 AATCACTGACTATTACTAAAAGG + Intergenic
1045795068 8:106033189-106033211 AAGCAATTATAATTTGTAAATGG + Intergenic
1045917259 8:107486975-107486997 TAGCACCTGCAATTAACAAAGGG - Intronic
1046497971 8:115038647-115038669 AAGCACTTAAAATGGTTAAAAGG - Intergenic
1046864996 8:119138227-119138249 AAGCACTAATAATTAAAAAAAGG - Intergenic
1046895907 8:119473081-119473103 AAGAAGTTACAAATAATCAAAGG + Intergenic
1047078221 8:121429689-121429711 AAGGTCTTACACTTTATAAATGG + Intergenic
1047441517 8:124883118-124883140 AAGCTCATACAACCAATAAATGG - Intergenic
1047617254 8:126572846-126572868 AAGCACTAGCAATCAATAAAGGG - Intergenic
1047930591 8:129724848-129724870 AAGAAATAACAATTAACAAAGGG + Intergenic
1048259393 8:132932899-132932921 AAGCAATTAAAATGTATAAAAGG + Intronic
1048526047 8:135203814-135203836 AAACACTTCCATTTAAAAAATGG + Intergenic
1049131985 8:140853671-140853693 AAGCACTCATGGTTAATAAAGGG - Intronic
1050070462 9:1806614-1806636 AAGGACAATCAATTAATAAATGG - Intergenic
1052028164 9:23597859-23597881 AATCACTCACAATTAGTAAAGGG + Intergenic
1053545193 9:39015761-39015783 AAACTCTTAAAATTAAAAAAAGG - Intergenic
1054977669 9:71166900-71166922 ATTCACTTGTAATTAATAAAAGG + Intronic
1055549924 9:77423907-77423929 AAGCACTTGCAAATAAAACAAGG + Exonic
1055696784 9:78893450-78893472 AAGCACTTAAAGTGAATAATAGG - Intergenic
1056022247 9:82451388-82451410 ATGCCCTTACAATTTATAATGGG - Intergenic
1056413101 9:86351523-86351545 AAGCACTTATTAATATTAAATGG - Intronic
1056649907 9:88449947-88449969 AATCACTAACAATTACTGAAGGG - Intronic
1056749367 9:89336061-89336083 AAGCACTTAAAATTACTTAAGGG - Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1057573880 9:96224491-96224513 AACCTCTTAGAACTAATAAATGG + Intergenic
1058170931 9:101680417-101680439 AAACATTTATTATTAATAAAAGG + Intronic
1058578029 9:106424407-106424429 AGTGATTTACAATTAATAAAGGG + Intergenic
1059160079 9:112025732-112025754 AAGAACTGAAAATTAAGAAAAGG + Intergenic
1059209825 9:112503235-112503257 AAGCACTTAAAATGAATGAGAGG + Intronic
1059916122 9:119103110-119103132 AACCACATAAAATTAATTAATGG - Intergenic
1203659620 Un_KI270753v1:29542-29564 GAGCACTTACCATTGATTAAAGG - Intergenic
1187061885 X:15794552-15794574 AACCACTTCCATTTAATGAAGGG - Intronic
1189073866 X:37895257-37895279 AAGATCATACAATTATTAAATGG - Intronic
1190852544 X:54260504-54260526 AATCACTTGCAATTATTAATGGG + Intronic
1191003931 X:55690179-55690201 ATGCAATAAAAATTAATAAAGGG + Intergenic
1191607047 X:63073429-63073451 AAGCATTTTCAAATAAGAAATGG - Intergenic
1192217669 X:69174551-69174573 AAGCATTTACACTTAAAAATGGG - Intergenic
1192602831 X:72482776-72482798 AAGGTCTCACAATTAGTAAATGG - Intronic
1193193545 X:78602655-78602677 ATGTACTTACTATTAAAAAAAGG + Intergenic
1193252802 X:79311842-79311864 AACCACCTGCAATTAAAAAAAGG + Intergenic
1193276861 X:79599299-79599321 ATGCATTTAGAATTAATATAAGG - Intergenic
1193357966 X:80544387-80544409 AAGCATTTCCAAGTGATAAAGGG + Intergenic
1193766606 X:85535949-85535971 AAGCTGTTAGAACTAATAAAAGG + Intergenic
1194448408 X:94013857-94013879 AAAAACCTACAATTAAAAAATGG - Intergenic
1194460188 X:94157209-94157231 AACAATTTAGAATTAATAAATGG + Intergenic
1194507957 X:94756083-94756105 AAGCACTGTCAAGTAAGAAATGG - Intergenic
1194616690 X:96112286-96112308 AATCACTTCCAAAAAATAAAAGG - Intergenic
1196473353 X:116053717-116053739 AAGGACTTCCTATCAATAAATGG - Intergenic
1197890023 X:131260677-131260699 AAGCATTTACAATTCATGAAGGG + Intergenic
1198313310 X:135441088-135441110 AAGCCATTATAATAAATAAATGG + Intergenic
1200285333 X:154816935-154816957 AAGCATTTACACTTAAAAAGTGG + Intronic
1200419375 Y:2947726-2947748 AAGCAGTTACAGTTTATAAAGGG + Intronic
1200754972 Y:6982574-6982596 AAAGACTTGTAATTAATAAAAGG + Intronic
1201590185 Y:15606080-15606102 AATCACTTACAATCAATTCAGGG - Intergenic
1202143635 Y:21755317-21755339 AGGCACTTACAAGTATTAGAAGG - Intergenic