ID: 1080820130

View in Genome Browser
Species Human (GRCh38)
Location 11:35797765-35797787
Sequence AAGTTTCCATAGGCTCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 14, 3: 76, 4: 394}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080820130_1080820135 22 Left 1080820130 11:35797765-35797787 CCGAGAGGAGCCTATGGAAACTT 0: 1
1: 0
2: 14
3: 76
4: 394
Right 1080820135 11:35797810-35797832 AGTGAAATCTGGAGCAGGAAAGG 0: 1
1: 1
2: 2
3: 38
4: 367
1080820130_1080820133 11 Left 1080820130 11:35797765-35797787 CCGAGAGGAGCCTATGGAAACTT 0: 1
1: 0
2: 14
3: 76
4: 394
Right 1080820133 11:35797799-35797821 GTGGTATTCTGAGTGAAATCTGG 0: 1
1: 0
2: 0
3: 10
4: 138
1080820130_1080820136 23 Left 1080820130 11:35797765-35797787 CCGAGAGGAGCCTATGGAAACTT 0: 1
1: 0
2: 14
3: 76
4: 394
Right 1080820136 11:35797811-35797833 GTGAAATCTGGAGCAGGAAAGGG 0: 1
1: 1
2: 2
3: 44
4: 432
1080820130_1080820134 17 Left 1080820130 11:35797765-35797787 CCGAGAGGAGCCTATGGAAACTT 0: 1
1: 0
2: 14
3: 76
4: 394
Right 1080820134 11:35797805-35797827 TTCTGAGTGAAATCTGGAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 173
1080820130_1080820132 -8 Left 1080820130 11:35797765-35797787 CCGAGAGGAGCCTATGGAAACTT 0: 1
1: 0
2: 14
3: 76
4: 394
Right 1080820132 11:35797780-35797802 GGAAACTTAATGATGAAATGTGG 0: 1
1: 0
2: 1
3: 25
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080820130 Original CRISPR AAGTTTCCATAGGCTCCTCT CGG (reversed) Intronic
900429428 1:2594813-2594835 AAGCTTCCTGAGGCTCCGCTGGG + Exonic
900702392 1:4056315-4056337 AAGTTTCCTGAGGCCTCTCTAGG + Intergenic
900704406 1:4071035-4071057 ACGTCTCCTTGGGCTCCTCTTGG + Intergenic
902358820 1:15930058-15930080 AGGATCCCATAGGCTCCCCTAGG + Exonic
902732609 1:18379282-18379304 AATCTTCCATGGGCTCTTCTTGG - Intergenic
905498540 1:38417126-38417148 ACGTCTCCTTAGGTTCCTCTTGG + Intergenic
906570274 1:46832034-46832056 TAATCTCCTTAGGCTCCTCTTGG + Intergenic
907283382 1:53365232-53365254 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
908184181 1:61636037-61636059 CAGTACCCGTAGGCTCCTCTTGG + Intergenic
908576781 1:65468202-65468224 ATGTCTCCTTAGTCTCCTCTTGG - Intronic
908766971 1:67563017-67563039 AGGTCTCCTTAGGCTTCTCTTGG - Intergenic
908819385 1:68067808-68067830 ATGTCTCCTTAGGCTTCTCTTGG + Intergenic
908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG + Intronic
909790126 1:79666356-79666378 GGGATTCCATAGTCTCCTCTGGG + Intergenic
909799439 1:79787608-79787630 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
910219076 1:84872032-84872054 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
910219182 1:84873095-84873117 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
910900764 1:92118237-92118259 CTGTCTCCTTAGGCTCCTCTTGG + Intronic
911834603 1:102600740-102600762 ATGTCTCCTTAGGCTTCTCTTGG + Intergenic
912278246 1:108283818-108283840 ACATCTCCTTAGGCTCCTCTTGG - Intergenic
912289980 1:108410539-108410561 ACATCTCCTTAGGCTCCTCTTGG + Intronic
912333639 1:108842808-108842830 GGGTTTTCTTAGGCTCCTCTGGG + Intronic
916256934 1:162798362-162798384 ATGTCTCCTTAGGCTCTTCTTGG + Intronic
916332184 1:163629015-163629037 AAGTCTCCTTAGGCTCCTCTTGG + Intergenic
916365022 1:164016851-164016873 ATGTTTCCTTAGGCTCCTCTTGG - Intergenic
916689277 1:167174849-167174871 ATGTCTGCTTAGGCTCCTCTTGG - Intergenic
917155425 1:171992682-171992704 AACTTTCAAAAGTCTCCTCTTGG - Intronic
917543655 1:175939705-175939727 AAGTCTCCTTAGGCTCTTCATGG + Intergenic
919315095 1:195962420-195962442 GAGTTTCCATAGCCTTCTGTTGG - Intergenic
919813180 1:201421742-201421764 CAGTTTTCATAGCCTCCCCTCGG - Exonic
919852571 1:201683099-201683121 AGATTTCCTTAGGCCCCTCTAGG + Intronic
920707751 1:208266879-208266901 ATGTTTCCCTAGGTTCCTCTTGG + Intergenic
921673085 1:217947980-217948002 ATGTCTCCTTAGGTTCCTCTTGG - Intergenic
921816639 1:219571476-219571498 ATGTCTCCATAGGCTTCTCTTGG + Intergenic
921895330 1:220394072-220394094 ACGTCTCCTTAGACTCCTCTTGG - Intergenic
922077107 1:222255465-222255487 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
922235961 1:223722905-223722927 AAGTCTCCTTCGGCTCCTCTGGG + Intronic
923071883 1:230573138-230573160 AGGTTTCCCTGGGGTCCTCTTGG + Intergenic
923352506 1:233123020-233123042 CTGTTTCCTTAGGCTCCTCTTGG - Intronic
1062865594 10:849945-849967 ACGTCTCCTTAGGCTCCTCTTGG - Intronic
1066160683 10:32724282-32724304 AAATTTCCATGGGATCCTCGGGG + Intronic
1066691621 10:38034314-38034336 ATGTCTCTTTAGGCTCCTCTTGG + Intronic
1066723396 10:38364057-38364079 ATGTCTCCTTAGGCTCTTCTTGG + Intergenic
1067001079 10:42614348-42614370 ATGTCTCTTTAGGCTCCTCTTGG - Intronic
1067074771 10:43170979-43171001 ATGTCTCCTTAGTCTCCTCTTGG - Intronic
1067487789 10:46668076-46668098 ACGTCTCCTTAGGGTCCTCTTGG - Intergenic
1067607018 10:47673931-47673953 ACGTCTCCTTAGGGTCCTCTTGG + Intergenic
1067700997 10:48571999-48572021 AGGTTTCCCTAGGTTCCCCTTGG - Intronic
1068350843 10:55843120-55843142 ATGTCTCCCTAGGCTTCTCTTGG + Intergenic
1068563716 10:58547249-58547271 ATGTCTCCCTTGGCTCCTCTTGG + Intronic
1069095577 10:64255468-64255490 CATTTTCCTTAGGTTCCTCTTGG + Intergenic
1069732398 10:70625861-70625883 AGGTTTCCCTAGGATCCCCTTGG - Intergenic
1070839911 10:79477896-79477918 ATGTCTCCTTAGCCTCCTCTTGG - Intergenic
1070984957 10:80680793-80680815 ATGTCTCCTTAGGCTCCTCCTGG + Intergenic
1071118897 10:82255296-82255318 ATGTTTCCTTAGCCTCCCCTTGG - Intronic
1071488393 10:86118943-86118965 AGGTCTCCTTAGGCACCTCTTGG - Intronic
1071882899 10:89918729-89918751 CTGTTTCCAGAGGGTCCTCTAGG + Intergenic
1072418771 10:95271614-95271636 ACGTTTCCATAGGCTTCACCTGG + Exonic
1072474164 10:95743101-95743123 ATGACTCCTTAGGCTCCTCTTGG + Intronic
1073478090 10:103767483-103767505 GGGTTTCCAGAGGCTCCTTTGGG + Intronic
1073708036 10:106009531-106009553 TTGTCTCCATAGGGTCCTCTGGG + Intergenic
1074334341 10:112554289-112554311 AAGTTTCCTTAAGTTCCTCTGGG - Intronic
1074569029 10:114607797-114607819 ACATCTCCGTAGGCTCCTCTTGG - Intronic
1075317526 10:121464873-121464895 TGGTTTCCCTAGCCTCCTCTTGG - Intergenic
1075571386 10:123548867-123548889 AAGTTTCCATGTGCTTCTCAGGG - Intergenic
1076084678 10:127616077-127616099 ACGTCTCCTCAGGCTCCTCTTGG - Intergenic
1076156409 10:128209222-128209244 CTGTTTCCCTAGGCTCTTCTTGG - Intergenic
1077960339 11:7070459-7070481 AAGTCTCCATTGGCTTCTCAGGG + Intronic
1078571646 11:12463330-12463352 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1079459528 11:20668291-20668313 AGGTTTCCTTGGACTCCTCTGGG + Intergenic
1079593621 11:22213315-22213337 ATGTCTCCTCAGGCTCCTCTTGG + Intronic
1080200010 11:29657900-29657922 AAGTTTCCATTGGCTTCATTTGG - Intergenic
1080820130 11:35797765-35797787 AAGTTTCCATAGGCTCCTCTCGG - Intronic
1080971672 11:37284861-37284883 AATTTTCAAAAAGCTCCTCTGGG + Intergenic
1080989580 11:37514886-37514908 ATGTCTCCTTAGGCTCCCCTTGG + Intergenic
1083066144 11:59925641-59925663 AAGGGTCCATAGACTCCTGTTGG - Intergenic
1084108746 11:66999015-66999037 ATGTCTCCTTAAGCTCCTCTTGG - Intergenic
1085759421 11:79228976-79228998 ATGTGTCCTCAGGCTCCTCTTGG + Intronic
1085916098 11:80890092-80890114 ACGTCTCCTTAGGCTTCTCTGGG + Intergenic
1085996667 11:81925009-81925031 ATGTCTCCTTAGGCTGCTCTCGG + Intergenic
1086413006 11:86560815-86560837 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1086471344 11:87115853-87115875 AAGTTTCCCTAGGATCTTCTTGG - Intronic
1086675362 11:89600011-89600033 ATGTCTCCTTAGGCTCCTTTAGG + Intergenic
1087662582 11:101004550-101004572 ACGTCTCCTTAGGCTCCTCTTGG - Intergenic
1088183420 11:107137358-107137380 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1088440071 11:109860438-109860460 AAGTTTCCTTTGCCTACTCTTGG + Intergenic
1088492114 11:110398328-110398350 AAGTGTCCACAGACTCCTGTTGG - Intergenic
1088802529 11:113319326-113319348 ATGTCTCCTTAGGCTTCTCTAGG - Intronic
1089370001 11:117948600-117948622 ATGTCTCCATAGGCTCCTCTTGG - Intergenic
1089642220 11:119855275-119855297 AAGTTTCCATAAACTCCACCAGG - Intergenic
1091777196 12:3192291-3192313 AAGATTGCATTGGCTGCTCTTGG + Intronic
1092139049 12:6170223-6170245 ATGTCTCTGTAGGCTCCTCTTGG - Intergenic
1092354169 12:7780990-7781012 ATGTCTCCTTTGGCTCCTCTCGG - Intergenic
1093164129 12:15786399-15786421 ATGTCTCCCTAGGCTCCTCTTGG - Intronic
1093237548 12:16629764-16629786 AATTTTTCATAAGCCCCTCTAGG + Intergenic
1093443010 12:19221851-19221873 ATGTCTCCTTAGGCTTCTCTTGG - Intronic
1094345948 12:29469429-29469451 AAGTCTCCTCAGGCTCTTCTTGG - Intronic
1096017261 12:48288237-48288259 ATGTCTCCTTAGACTCCTCTCGG + Intergenic
1096108385 12:49012796-49012818 AAACTTCCATAGGCAACTCTGGG - Intronic
1097235802 12:57538679-57538701 AAATTTCGCTAGGCTCCCCTGGG - Intronic
1097949013 12:65405334-65405356 AAGTTTACATAATGTCCTCTAGG + Intronic
1098096871 12:66966580-66966602 ATGTTTCCTTACGGTCCTCTTGG + Intergenic
1098705250 12:73678791-73678813 ATGTTCCCTTAGTCTCCTCTTGG - Intergenic
1100083894 12:90883696-90883718 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1101599567 12:106197444-106197466 GTGTTTCTTTAGGCTCCTCTGGG + Intergenic
1102110560 12:110362804-110362826 ATGTCTCCTTAGGCTCCTCATGG - Intergenic
1102256776 12:111419886-111419908 ACGTCTCCTTAGGCGCCTCTTGG + Intronic
1102541625 12:113623822-113623844 AAGTCTCCTGAGGCTCCTCTTGG + Intergenic
1104124788 12:125835994-125836016 GGGTCTCCTTAGGCTCCTCTTGG + Intergenic
1105619944 13:22057053-22057075 ACGTTGCTTTAGGCTCCTCTGGG + Intergenic
1106127985 13:26916396-26916418 ATGTCTCCTTAGGCTCCTCTGGG + Intergenic
1106730945 13:32540888-32540910 ATGTTTCCTTAGGCTCCTTTTGG + Intergenic
1107019780 13:35739813-35739835 AAGTTTCTCTGGGTTCCTCTTGG - Intergenic
1107630702 13:42340155-42340177 ACGTCTCCATAGGCTCCTCTTGG + Intergenic
1108125939 13:47242777-47242799 ATGTCTCCTTAAGCTCCTCTTGG + Intergenic
1108334420 13:49424449-49424471 ATGTCTCCTTAGGCTCCTTTTGG - Intronic
1109129730 13:58568137-58568159 ATGTCTCACTAGGCTCCTCTTGG + Intergenic
1109228651 13:59728007-59728029 AAGTTTCCATGTACTACTCTAGG - Intronic
1109812853 13:67538008-67538030 TTGTTTCCTTAGGCTACTCTTGG - Intergenic
1110009693 13:70316631-70316653 ATGTTTCCATGGGATCCTCTAGG + Intergenic
1110429225 13:75404423-75404445 ATGTCTCCCTAAGCTCCTCTTGG + Intronic
1111775113 13:92651536-92651558 ATGTCTCTATAGGCTCCTCTTGG - Intronic
1111817160 13:93168309-93168331 ATGTCTCCTTAGGCACCTCTGGG - Intergenic
1113332145 13:109339470-109339492 ATGTCTCCTTAGTCTCCTCTTGG + Intergenic
1114467240 14:22931758-22931780 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1115503083 14:34066398-34066420 ACGTCTCCTTAGGCTCCTTTTGG - Intronic
1115925460 14:38428542-38428564 ATGTCTCCTCAGGCTCCTCTTGG + Intergenic
1116116269 14:40654914-40654936 AGGTCTCCTTAGGCTCCTCTTGG - Intergenic
1116324293 14:43512222-43512244 ATGTCTCCATAGGGTCCTCTTGG + Intergenic
1117300988 14:54427710-54427732 CAGATTCCACAGGCTACTCTTGG + Exonic
1117835743 14:59804143-59804165 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1118362404 14:65067471-65067493 ATGTCTCCTTAGACTCCTCTTGG + Intronic
1118882203 14:69838855-69838877 ATGTTTCCTTAGCTTCCTCTTGG + Intergenic
1118883285 14:69846706-69846728 ATGTCTCCATAGGCTTCTCTTGG + Intergenic
1119623459 14:76150947-76150969 ATGCCTCCTTAGGCTCCTCTTGG + Intergenic
1119738922 14:77001260-77001282 GAGTTTCCATTGGCGCCTGTGGG - Intergenic
1120223804 14:81767261-81767283 AGGTTTCCCTAGGGTCCCCTTGG - Intergenic
1120716051 14:87841798-87841820 ATGTCTCCTTAGGTTCCTCTTGG + Intronic
1120895927 14:89532234-89532256 AAGTTTCCATGGCTTTCTCTGGG - Intronic
1120896487 14:89537358-89537380 AACATTCCATAGACTCCTCTAGG - Intronic
1121488211 14:94337385-94337407 ATGTTTCCTTAGGCTTCTCTTGG + Intergenic
1121677214 14:95763256-95763278 ACGTCCCCTTAGGCTCCTCTTGG - Intergenic
1122755766 14:103978553-103978575 ATGTTTCCTTAGGCTCCTCTTGG + Intronic
1122849375 14:104519162-104519184 ACGTCTCCTTAGGCTCCTCCTGG - Intronic
1123047233 14:105524895-105524917 AAGTTCAAATAGGCTCCTGTGGG + Intergenic
1123808753 15:23901885-23901907 AAGTTTCTTTAGGCTCCTTTTGG + Intergenic
1124699363 15:31898955-31898977 ATGTTTTCTTAGGCTTCTCTTGG - Intergenic
1125111178 15:36036428-36036450 ATGTCTCCTTAGGGTCCTCTTGG - Intergenic
1125683745 15:41549936-41549958 AAGTCCCCTTAGGCGCCTCTTGG + Intergenic
1125694879 15:41627337-41627359 ATGTCTCCTTAGGATCCTCTTGG + Intronic
1125922364 15:43532652-43532674 TAACTGCCATAGGCTCCTCTTGG + Intergenic
1125985911 15:44051653-44051675 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1126904549 15:53350279-53350301 ACGTCTCCTTAGTCTCCTCTTGG - Intergenic
1128093896 15:64938578-64938600 ATGTCTCCCTATGCTCCTCTTGG - Intronic
1128361714 15:66966362-66966384 ATGTCACCATAGGCTCCTCTTGG + Intergenic
1128840301 15:70845293-70845315 ATGTCTCCTGAGGCTCCTCTTGG + Intronic
1129351002 15:74956056-74956078 GGGTTCCCCTAGGCTCCTCTTGG + Exonic
1130048341 15:80463333-80463355 AAGTTTGGAAGGGCTCCTCTTGG - Intronic
1130126437 15:81097895-81097917 ATGTTTCCTTAGACTCCTTTGGG + Intronic
1131928035 15:97407717-97407739 ATGTCTCCTTAGGCTCCTTTTGG + Intergenic
1132120324 15:99170099-99170121 AAGTTTGTCTATGCTCCTCTGGG + Intronic
1132190408 15:99851151-99851173 ATGTCTCTATAGGCTCCTCTTGG + Intergenic
1136661699 16:31768693-31768715 ACCTACCCATAGGCTCCTCTAGG - Intronic
1137528511 16:49260690-49260712 ACGTCTCCTTAGGCTCCTCTTGG - Intergenic
1138628327 16:58271534-58271556 ATGTCTCCTTAAGCTCCTCTTGG + Intronic
1138641886 16:58394196-58394218 ATGTTTCCTTAGCCTTCTCTTGG + Intronic
1138880458 16:61007859-61007881 ATGTTTCCTAAGGCTCCGCTAGG + Intergenic
1138914277 16:61444020-61444042 AAGTCTTCTTAGGCTTCTCTTGG - Intergenic
1139471859 16:67182388-67182410 AAGTTTCCATAGGCAAGTCCTGG - Intronic
1140029498 16:71323800-71323822 ACGTCACCTTAGGCTCCTCTTGG - Intergenic
1141152041 16:81570898-81570920 ACGTGTCCGCAGGCTCCTCTGGG - Intronic
1141748407 16:85941814-85941836 GGGTTTCCGTGGGCTCCTCTTGG + Intergenic
1141818413 16:86428800-86428822 ATGCCTCCTTAGGCTCCTCTTGG + Intergenic
1147349879 17:39833995-39834017 TTGTCTCCTTAGGCTCCTCTTGG + Intronic
1147358252 17:39914378-39914400 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
1149309030 17:55376319-55376341 CTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1149492831 17:57097459-57097481 AAGATTCCAAAAGCGCCTCTTGG - Intronic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151843174 17:76632176-76632198 AAGTTTCCATAGGCTTCTTGAGG - Intronic
1153205050 18:2690135-2690157 ATGTTTCAGTAGGCTTCTCTAGG - Intronic
1153265431 18:3264114-3264136 AAGTTTCCTTAGGGATCTCTTGG + Intronic
1154347519 18:13555138-13555160 GTGTCTCCTTAGGCTCCTCTTGG - Intronic
1154387555 18:13909099-13909121 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1156114092 18:33766336-33766358 ATGTCTTCATAGGCTCCTGTTGG + Intergenic
1157048489 18:44132083-44132105 GAGTTTCCATAGTCTTCACTGGG + Intergenic
1157296048 18:46445323-46445345 AAGTCTCAAAAGGCTCTTCTGGG + Intronic
1157356259 18:46937332-46937354 ATGTCTCCTTAGTCTCCTCTAGG - Intronic
1158534171 18:58292415-58292437 AACTCTCCACAGGCTCCCCTGGG + Intronic
1159849311 18:73508075-73508097 AAGTTTCCTTCAGCTCCTCTTGG + Intergenic
1159854645 18:73570072-73570094 AGCTTTCATTAGGCTCCTCTTGG - Intergenic
1162561033 19:11418428-11418450 AGTTGTCCCTAGGCTCCTCTCGG + Intronic
1162681997 19:12352003-12352025 AAATTACCTTAGGCTCCTCCTGG + Exonic
1164261947 19:23575859-23575881 AAGTGTCCACAGACTCCTGTTGG + Intronic
1166585302 19:43941347-43941369 ATGTCTCCCTAGGCTCCTCTTGG + Intergenic
1167829390 19:52007345-52007367 AAGTTTCCAGCGTATCCTCTTGG - Intronic
1168422162 19:56211515-56211537 ACGTCTCCCTAGGATCCTCTTGG + Intergenic
1168423395 19:56219868-56219890 ACGTCTCCCTAGGATCCTCTTGG - Exonic
1168427405 19:56249809-56249831 ATGCCTCCCTAGGCTCCTCTTGG + Intronic
925545101 2:5007234-5007256 ATGTTTCCTTAGGCACTTCTGGG - Intergenic
926498163 2:13617260-13617282 ATGTCTCCTTAAGCTCCTCTTGG - Intergenic
926798147 2:16635794-16635816 AGGTTTTCAAAGGCTCCTCTGGG + Intronic
927013615 2:18932518-18932540 CAGACTCCTTAGGCTCCTCTTGG + Intergenic
927121447 2:19967979-19968001 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
928031304 2:27782098-27782120 ATATTTCCATAGACTCCTGTAGG + Intronic
928247639 2:29644977-29644999 AATTCTCCATAGGGTCCTCCAGG + Intronic
928344899 2:30482957-30482979 ATGTCTCCCTTGGCTCCTCTTGG - Intronic
928432475 2:31232526-31232548 AAGTTTCCTGAGGCCTCTCTAGG - Intronic
929362879 2:41116159-41116181 AAGTCTCCTCAGGCTCTTCTTGG + Intergenic
930268103 2:49223464-49223486 CACTTTCCATAATCTCCTCTTGG + Intergenic
931318543 2:61154371-61154393 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
931709379 2:64975033-64975055 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
932046998 2:68359568-68359590 ATGTCTCCTTAGGCTTCTCTTGG + Intergenic
932271693 2:70416007-70416029 AAGTTAGCATGGGTTCCTCTTGG - Intergenic
932843309 2:75105907-75105929 ATGTCTCTTTAGGCTCCTCTTGG - Intronic
933106636 2:78336210-78336232 ATGTCTACTTAGGCTCCTCTTGG + Intergenic
933375111 2:81469047-81469069 ATGTTTCCTTAGGCTTCTCTTGG + Intergenic
933540481 2:83634963-83634985 ATGTCTCTTTAGGCTCCTCTTGG - Intergenic
933834330 2:86232977-86232999 AATTTTCCAGGGCCTCCTCTGGG + Intronic
935879961 2:107555422-107555444 ATGTCTTCTTAGGCTCCTCTTGG - Intergenic
936382646 2:112000404-112000426 ACATCTCCTTAGGCTCCTCTTGG + Intronic
936768742 2:115886090-115886112 ATGTCTTCATAGGTTCCTCTTGG - Intergenic
936814820 2:116446811-116446833 AGGTTTCCTTAGGCTACTCTTGG - Intergenic
937559082 2:123198636-123198658 ATGTCTCCTTCGGCTCCTCTTGG + Intergenic
937685935 2:124697359-124697381 ATGCCTCCTTAGGCTCCTCTTGG + Intronic
937790500 2:125955903-125955925 AGGTCTCCTTAGGCTCCTCTTGG + Intergenic
937951651 2:127392648-127392670 ACGTCTCCTTAGGCTTCTCTTGG + Intergenic
939754474 2:146093261-146093283 AAGTTTCCTGAGGCTTCCCTAGG - Intergenic
941063999 2:160880161-160880183 ACTTTTCCTTAGGCACCTCTGGG + Intergenic
941342057 2:164318843-164318865 ATGTCTTCCTAGGCTCCTCTTGG + Intergenic
941348976 2:164408030-164408052 ATGTCTCCTTAGGCTTCTCTTGG - Intergenic
942137125 2:172937330-172937352 ATGTCTCCTTAGGCTCCTTTTGG + Intronic
942979163 2:182058184-182058206 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
942980183 2:182071225-182071247 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
942982812 2:182102773-182102795 AAATTTTCAAATGCTCCTCTAGG - Intronic
943427186 2:187751166-187751188 AAGTTTGCATTGGATCTTCTTGG + Intergenic
943431636 2:187810067-187810089 ATGCCTCCTTAGGCTCCTCTTGG - Intergenic
943535172 2:189139506-189139528 ATGTCTCCTTAGGCTCCTTTTGG - Intronic
945144008 2:206716813-206716835 AAGTTCCCAGATGCTGCTCTTGG + Intronic
945558321 2:211306493-211306515 ATGTCTCCATAGGCTCCTCTTGG - Intergenic
946127569 2:217577296-217577318 ATGTCTCCTTAGGCTCCCCTTGG - Intronic
946799147 2:223391657-223391679 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
947210353 2:227702987-227703009 GATCTTCCATATGCTCCTCTGGG - Intronic
947921363 2:233877623-233877645 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
1169418239 20:5436315-5436337 ATGTTCCCTTAGGCTCCTCTTGG + Intergenic
1169797515 20:9480278-9480300 GGGTTTCCATGCGCTCCTCTTGG - Exonic
1171104458 20:22419492-22419514 AAGTCTCCCTAGGTTCCTCGTGG - Intergenic
1172908401 20:38387068-38387090 AAGTCTCCTGAGGCTCCCCTGGG - Intergenic
1173133001 20:40411944-40411966 GAGTTTCCCGAGGTTCCTCTTGG - Intergenic
1173714022 20:45186167-45186189 ATGTCTTCTTAGGCTCCTCTTGG + Intergenic
1174668735 20:52285451-52285473 AACCTTCCAAAGGCTCCCCTTGG - Intergenic
1174728260 20:52888264-52888286 ATGTCTCCATAGGCTCCTCCTGG - Intergenic
1177357119 21:20022616-20022638 AAGTTTCCTTTGGCTGTTCTTGG + Intergenic
1178207364 21:30485553-30485575 AAGTTTCCTGAGGCCTCTCTAGG + Intronic
1179062137 21:37988982-37989004 AAGTTTCCATTGCCTCTCCTTGG - Intronic
1179172679 21:38984796-38984818 AAGGGTCCATAGGCTTCCCTAGG + Intergenic
1179461226 21:41536610-41536632 ATGTTTCCTTAGGCACATCTTGG + Intergenic
1181635705 22:24173498-24173520 AAGCCTTCACAGGCTCCTCTGGG - Intronic
1181739843 22:24912127-24912149 ATGTTCCCTTAAGCTCCTCTTGG - Intronic
1182536898 22:31010654-31010676 ATCTTTCCTTAGGCTCCCCTTGG - Intergenic
1184694220 22:46130891-46130913 AACTTTCAAAAGACTCCTCTGGG - Intergenic
1185170265 22:49289504-49289526 ACGCTTCCTGAGGCTCCTCTTGG - Intergenic
949697871 3:6720238-6720260 ATGTTTCCTTAAGTTCCTCTTGG - Intergenic
949739929 3:7220525-7220547 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
949833739 3:8245427-8245449 ATGCCTCCTTAGGCTCCTCTTGG + Intergenic
950128431 3:10525623-10525645 ATGTCTCCTTAGGTTCCTCTCGG + Intronic
950933834 3:16818573-16818595 GTGTTTCCCTAGACTCCTCTAGG - Intronic
952697702 3:36289271-36289293 ATGTTTACTTAGGCTCCTCATGG + Intergenic
952703782 3:36355030-36355052 ACATCTCCCTAGGCTCCTCTTGG + Intergenic
952913677 3:38213439-38213461 ATGTCTCCTTAGGCTCCTTTTGG - Intronic
954636737 3:52074983-52075005 AAGTTTCCATTTGCTCCTGAGGG - Intergenic
955457656 3:59141564-59141586 CAGTTTCCTCAGTCTCCTCTCGG - Intergenic
956006596 3:64785649-64785671 ATGTATTCTTAGGCTCCTCTTGG - Intergenic
957315616 3:78572233-78572255 AAGTTTTCAGAGTCTCCTCCCGG - Intergenic
957679908 3:83420387-83420409 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
958516091 3:95117630-95117652 ATGTCTCCATAGGCTGCTATTGG + Intergenic
959404847 3:105948692-105948714 ATGCCTCCTTAGGCTCCTCTTGG + Intergenic
960226321 3:115173626-115173648 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
960250977 3:115453094-115453116 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
960482044 3:118203659-118203681 AACTTTTCTTAGGTTCCTCTTGG + Intergenic
961341819 3:126228774-126228796 ATGTCTCCTTAGGCTCTTCTTGG + Intergenic
962496778 3:135947847-135947869 ATGTCTCCTTAGGATCCTCTTGG + Intergenic
962802821 3:138904896-138904918 ATGTCTCCTTAGGCTCCTGTTGG + Intergenic
963073741 3:141327563-141327585 ACGTCTCCTTAGGCTCCTCTGGG - Intronic
963109751 3:141678140-141678162 AATTTTCCCTAGGGTCCTTTGGG + Intergenic
963492852 3:146022546-146022568 GTGTCTCCTTAGGCTCCTCTGGG - Intergenic
963907536 3:150785270-150785292 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
964865608 3:161256787-161256809 ATGTTTCCTTATGCTCCTCTTGG + Intergenic
967559648 3:190902910-190902932 AAGGTTCAATAGGGTCCACTTGG + Intergenic
967775573 3:193382553-193382575 AAGTTTCCATGGACTCATCCTGG + Intergenic
969573438 4:8023316-8023338 ACGTCTCCCAAGGCTCCTCTCGG + Intronic
970641576 4:18072137-18072159 AAGTGTCTTTAGGCTCTTCTTGG - Intergenic
971079014 4:23185950-23185972 ATGTCTCCATAGACTCTTCTTGG + Intergenic
971142869 4:23943982-23944004 ATGTCTCCATAGGCTTCTCTGGG - Intergenic
971818521 4:31521930-31521952 ATGTTTTCTTAGGCCCCTCTTGG + Intergenic
971914906 4:32856521-32856543 ATGTTTCCTTGGGATCCTCTTGG + Intergenic
972190179 4:36581642-36581664 ATGTCTCTGTAGGCTCCTCTGGG - Intergenic
972439043 4:39067174-39067196 ATGTCTCCTTAGCCTCCTCTTGG + Intronic
973130433 4:46641659-46641681 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
974699566 4:65423042-65423064 ATGTTTTCTTAGGCTCCTCTTGG + Intronic
975234291 4:71973261-71973283 ATGTGTCTTTAGGCTCCTCTTGG + Intergenic
975467632 4:74726657-74726679 ATGTCTCCTTAGACTCCTCTTGG - Intergenic
976286258 4:83374367-83374389 AAGTTTCTCTGGGGTCCTCTTGG - Intergenic
976733639 4:88288511-88288533 AAGTATCTGTAGGCTACTCTTGG + Intergenic
976916895 4:90387361-90387383 ATGTTTCCATAGGCTCTGCATGG - Intronic
976920064 4:90428867-90428889 ATATCTCCTTAGGCTCCTCTTGG - Intronic
977336819 4:95709932-95709954 AAGTTACCATAAGCACCACTTGG + Intergenic
977659727 4:99569311-99569333 AAGTATCTTTAGGCTCCTCTTGG - Intronic
977721155 4:100241733-100241755 AAGTTTCTCTGGGATCCTCTCGG + Intergenic
977755928 4:100671910-100671932 AAGTTTACATAAGCTGCTCGAGG + Intronic
978288928 4:107113936-107113958 ATGTCTCTCTAGGCTCCTCTTGG - Intronic
978905595 4:114001829-114001851 AAGTTTGGATGGGCTTCTCTAGG + Intergenic
979164831 4:117515862-117515884 AAGCTTTCAAAGGCTCCTCCAGG + Intergenic
980188386 4:129491971-129491993 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
980773988 4:137415595-137415617 AAATGGCCATAGGTTCCTCTGGG + Intergenic
981016758 4:139981676-139981698 ATGTTTCATTAGGCTCCTCTTGG + Intronic
981492905 4:145359654-145359676 ATGTCTCCTTAGGCTTCTCTTGG - Intergenic
983552407 4:169031474-169031496 CAGTTTCCGCAGGCACCTCTGGG + Intergenic
983564047 4:169131124-169131146 AAGTTTCCATTAGGTCCTCTGGG - Intronic
984924968 4:184798635-184798657 AAAATTCCAGTGGCTCCTCTCGG + Intronic
985194542 4:187414579-187414601 ATGTCTCCTTGGGCTCCTCTTGG + Intergenic
985359737 4:189160125-189160147 AAGATTGCATTGGCTCTTCTGGG + Intergenic
986298917 5:6462743-6462765 AAGTTTCCATAGAATTCTATGGG - Intronic
986697108 5:10367179-10367201 ATGTCTCCTTGGGCTCCTCTGGG - Intronic
988011147 5:25487843-25487865 ATGCTTCCTTAGGCTCCTCTCGG + Intergenic
988313641 5:29594586-29594608 ATGTCTCCTTAGACTCCTCTTGG - Intergenic
988917660 5:35911568-35911590 ATGTTTCCTTAGGATCCTGTTGG - Intronic
990109571 5:52306603-52306625 AAGTGTCCACAGACTCCTGTTGG - Intergenic
990208946 5:53460735-53460757 CTATTTCCTTAGGCTCCTCTTGG - Intergenic
990904085 5:60784589-60784611 AAGTTTCCTTACGCTACTCAGGG + Intronic
992892951 5:81220882-81220904 AAAATTCTTTAGGCTCCTCTTGG + Intronic
993497513 5:88623973-88623995 AAGTTTCCTTAGGATCTCCTTGG - Intergenic
993543069 5:89176218-89176240 ACGTCTCCTCAGGCTCCTCTTGG - Intergenic
993658604 5:90602645-90602667 ATGTTTCCTTGGGCTCCTTTTGG - Intronic
994114018 5:96041440-96041462 ATGTTTCCTTAGACTTCTCTTGG - Intergenic
994916565 5:105988052-105988074 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
997259822 5:132457222-132457244 AAGTCTCAATAAGCTTCTCTTGG - Intronic
997656103 5:135555672-135555694 ATGTCTCCTCAGGCTCCTCTTGG + Intergenic
999529926 5:152451737-152451759 ATGTCTCCATAGGCATCTCTTGG + Intergenic
1000128909 5:158275697-158275719 AAGCTTCCATATGTTCCTCTTGG + Intergenic
1002908172 6:1467862-1467884 ACGTTTCTATGGGGTCCTCTTGG + Intergenic
1004745874 6:18508608-18508630 ATGTCTCCTTAGACTCCTCTGGG + Intergenic
1004777373 6:18863020-18863042 ATGTCTCCATAGGTTCCTCTTGG + Intergenic
1004799327 6:19128937-19128959 GTGTTTTCTTAGGCTCCTCTTGG - Intergenic
1005216542 6:23534670-23534692 ACTTTCCCAGAGGCTCCTCTGGG - Intergenic
1005372221 6:25145676-25145698 ATGTCTCCTTAGGCTTCTCTTGG - Intergenic
1005523480 6:26622446-26622468 ATATCTCCTTAGGCTCCTCTTGG + Intergenic
1005877419 6:30022426-30022448 ATGCCTCCTTAGGCTCCTCTTGG - Intergenic
1005900376 6:30212275-30212297 ATGTCTCCTTATGCTCCTCTTGG - Intronic
1006379775 6:33690793-33690815 CAGTTTCCCAAGGCTCCTCCAGG - Intronic
1006882334 6:37351270-37351292 GTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1007117779 6:39356046-39356068 GTGTCTCCCTAGGCTCCTCTTGG + Intronic
1007174582 6:39887282-39887304 ACTTTTCCATAGGCTCCAATGGG - Intronic
1007851899 6:44811164-44811186 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1008159199 6:48056739-48056761 ATGTTTCAGTAGTCTCCTCTAGG + Intronic
1008546639 6:52589213-52589235 ACATCTCCAGAGGCTCCTCTCGG + Intergenic
1009548555 6:65055591-65055613 ATATTTCCTTAGGCTTCTCTTGG + Intronic
1010200974 6:73281824-73281846 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1010638972 6:78298763-78298785 AAGTATCCATAAGTTTCTCTTGG - Intergenic
1010783563 6:79973074-79973096 ATGTTTCCTTAGGCTCCTCTTGG - Intergenic
1010845416 6:80701555-80701577 AAGTTTCCTGAGGCTTCCCTAGG + Intergenic
1010925725 6:81743582-81743604 ATGTCTCTTTAGGCTCCTCTTGG + Intronic
1011000072 6:82578122-82578144 ATGACTCCTTAGGCTCCTCTTGG - Intergenic
1011221160 6:85055893-85055915 ATGTCTCCTTAGTCTCCTCTTGG - Intergenic
1011364520 6:86567082-86567104 ATGTCTTCTTAGGCTCCTCTTGG - Intergenic
1011425332 6:87222806-87222828 ATGTCTTCTTAGGCTCCTCTTGG + Intronic
1011571302 6:88738742-88738764 AAGTTCCCATATACACCTCTTGG - Intronic
1013185744 6:107756498-107756520 ATGTTTCCTTAAGCTCCTCTGGG - Intronic
1013264566 6:108482607-108482629 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1013402951 6:109816400-109816422 ACGTCTCCTTAGGCTCCTCTGGG - Intronic
1014070345 6:117174558-117174580 AAGTCTCCTTAGGCTCCTCTTGG - Intergenic
1017313866 6:153005769-153005791 ATGTTTCCTTAGGCTTCCCTTGG - Exonic
1017728737 6:157295633-157295655 ACGTTTCCATTTCCTCCTCTTGG + Intronic
1018594137 6:165460193-165460215 AAGGGTCCACAGGCTCCTGTTGG - Intronic
1020775953 7:12454136-12454158 AAGATTCCATAGGCACAGCTTGG + Intergenic
1020796189 7:12681113-12681135 AAGTTTCCATGGCCTCTTGTTGG - Intergenic
1021333756 7:19372459-19372481 CTGTTTCCTTAGGCTCCACTTGG + Intergenic
1021440618 7:20670120-20670142 ATGTCGCCTTAGGCTCCTCTTGG - Intronic
1021812111 7:24412765-24412787 CATTCTCCTTAGGCTCCTCTTGG - Intergenic
1021874318 7:25034287-25034309 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1021953281 7:25796979-25797001 ATGATTCCAGAGGCTCTTCTGGG - Intergenic
1022016283 7:26351536-26351558 GTGTTTCCTTGGGCTCCTCTTGG - Intronic
1022112763 7:27241463-27241485 AAGCTGCCATAGGCCTCTCTTGG - Intergenic
1022832067 7:34077722-34077744 ATGTTTCCATTGGATCCCCTTGG + Intronic
1022908873 7:34881144-34881166 ATGTTTCCTGAGGCTGCTCTTGG - Intergenic
1023584094 7:41710754-41710776 TAGTTTCCAGAAGCTCCTCATGG - Intergenic
1023663705 7:42497055-42497077 ATGTCTCCTTAGGCTTCTCTTGG + Intergenic
1023663715 7:42497197-42497219 ATGTCTCCTTAGGCTTCTCTTGG + Intergenic
1024108192 7:46115356-46115378 ATGTCTCCTTAGGCTCCTGTTGG + Intergenic
1025102463 7:56146974-56146996 AAGGGTCCACAGGCTCCTGTTGG - Intergenic
1026080079 7:67210129-67210151 AATTCTCTTTAGGCTCCTCTTGG + Intronic
1026595146 7:71728361-71728383 ACGTCTCCATAGGTGCCTCTTGG - Intergenic
1027127856 7:75569824-75569846 ATGTCTCCTTAGGTTCCTCTTGG - Intronic
1027679438 7:81201425-81201447 ACATCTCCGTAGGCTCCTCTTGG - Intergenic
1027808111 7:82855942-82855964 AACTTTCTAAAGGCACCTCTTGG - Intronic
1028085354 7:86629775-86629797 GTGTTTCTTTAGGCTCCTCTTGG + Intergenic
1028451885 7:90994354-90994376 CAGTTTCCATCTGGTCCTCTTGG - Intronic
1029391627 7:100278844-100278866 ATGTCTTCTTAGGCTCCTCTTGG + Intergenic
1030269433 7:107654564-107654586 CTGTTTCCTTAGGCTCCACTTGG - Intergenic
1030339782 7:108363897-108363919 ATGTCTCCCTAGGATCCTCTTGG - Intronic
1031297802 7:120026029-120026051 ATGTCCCCTTAGGCTCCTCTTGG + Intergenic
1031304184 7:120103349-120103371 AAGTTTCCCTGGGGTCCCCTTGG + Intergenic
1031598964 7:123680879-123680901 ATTTTTCAATAGGCTCCTCACGG + Intergenic
1031745268 7:125488146-125488168 ATGTTTCATTAGGCTCTTCTTGG - Intergenic
1031788840 7:126073184-126073206 TAGTTTTCATAGGGGCCTCTGGG + Intergenic
1031792977 7:126133793-126133815 ATGTGTCCTTGGGCTCCTCTTGG - Intergenic
1032120960 7:129156051-129156073 ATGTCTCCTTAGGTTCCTCTTGG + Intronic
1032124918 7:129186818-129186840 AAGTTTCCTGAGGCTTCTCCAGG - Intergenic
1032229574 7:130063012-130063034 AAGTGTCCATAGGCTCCACCAGG + Intergenic
1033290234 7:140077194-140077216 TAGTTTCCATCTGCCCCTCTAGG + Intergenic
1033413387 7:141140650-141140672 ATGTATCCTTGGGCTCCTCTTGG + Intronic
1034328227 7:150257633-150257655 AAGTTTCTAAGGGCTGCTCTAGG - Intronic
1034764989 7:153711831-153711853 AAGTTTCTAAGGGCTGCTCTAGG + Intergenic
1038033525 8:23665578-23665600 ATGTCTCCTGAGGCTCCTCTTGG + Intergenic
1038756801 8:30349277-30349299 TTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1039196734 8:35040501-35040523 ATGTCTCCTTAGGTTCCTCTTGG - Intergenic
1039559096 8:38498295-38498317 ATGTGCCCATAGGGTCCTCTTGG - Intergenic
1039714289 8:40091392-40091414 GTGTCTCCATAGGCTCCTTTTGG + Intergenic
1039829118 8:41198946-41198968 AAGTTTCCTGAGGCTTCCCTAGG + Intergenic
1040459889 8:47637183-47637205 ATGTCTCCTCAGGCTCCTCTTGG + Intronic
1040610479 8:48977702-48977724 AAGGCTCCAAAGGCTCCTCCAGG + Intergenic
1040914157 8:52552090-52552112 ATGTCTCCTTAGGCGCCTCTTGG + Intronic
1040998728 8:53428187-53428209 ATGTCTCCTTAGTCTCCTCTTGG - Intergenic
1041440690 8:57893195-57893217 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1041761549 8:61372674-61372696 ATGTTTCTTTAGGCTCCTCTTGG + Intronic
1042441836 8:68837290-68837312 ATGCTTCCTTAGGCTTCTCTTGG - Intergenic
1042582819 8:70300686-70300708 CAGTTTCCATTGCTTCCTCTGGG - Intronic
1042959950 8:74292998-74293020 ACGTTCCCAAAGGCTGCTCTAGG - Intronic
1043122140 8:76339566-76339588 ATGTCTCCTTAGGATCCTCTTGG - Intergenic
1044322105 8:90814074-90814096 ATGTCTCCTTAAGCTCCTCTTGG + Intronic
1044984232 8:97743840-97743862 AAGTTTTCATTGGCTCCTGCTGG - Intergenic
1045237857 8:100371731-100371753 ATGTCTCCTTAGACTCCTCTTGG + Intronic
1045416548 8:101973258-101973280 ATGTCTCCATAGGCTCCTCTTGG + Intronic
1045683297 8:104685667-104685689 ATGTCTTCTTAGGCTCCTCTTGG + Intronic
1047603728 8:126453295-126453317 AGGTCTCCTTAGCCTCCTCTAGG + Intergenic
1048640371 8:136351728-136351750 ATGCCTCCTTAGGCTCCTCTGGG - Intergenic
1049479371 8:142813587-142813609 ATGTTTACAGAGGCTCCTCTGGG - Intergenic
1050409202 9:5343972-5343994 ACGTCTCCTTAGGCTCCTCTTGG - Intergenic
1050835504 9:10073424-10073446 ATGTCTCTGTAGGCTCCTCTTGG - Intronic
1051261145 9:15265946-15265968 ATGTCCCCTTAGGCTCCTCTTGG - Intronic
1051542452 9:18235148-18235170 ATGTCTCCCTAGGCTCCCCTTGG + Intergenic
1053074123 9:35118331-35118353 ATGTCTCCTTTGGCTCCTCTTGG + Intergenic
1053089052 9:35256277-35256299 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1053326048 9:37152500-37152522 ATGTCTCCTTAGGCTTCTCTTGG + Intronic
1053328350 9:37177866-37177888 ATGTCTCCCTAGGCTCCTCTTGG - Intronic
1054734336 9:68735409-68735431 ATGTCTACTTAGGCTCCTCTGGG + Intronic
1054840883 9:69738086-69738108 ATGTCTCCTTATGCTCCTCTTGG + Intronic
1056322101 9:85445010-85445032 AACTTTCCATTCTCTCCTCTAGG + Intergenic
1058527736 9:105877160-105877182 ATATCTCCTTAGGCTCCTCTTGG - Intergenic
1058534011 9:105936223-105936245 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1059242551 9:112819626-112819648 ATGTCTCCTTAGGCTCTTCTTGG + Intronic
1059362904 9:113759774-113759796 ATGTCTCCTTAGGTTCCTCTGGG - Intergenic
1059636402 9:116175247-116175269 CAGTTTTCAAACGCTCCTCTTGG - Intronic
1059938492 9:119335161-119335183 CAGTTTCCAAAGGCCCTTCTGGG - Intronic
1060198286 9:121637137-121637159 AAATTTCCCTAGGCTCCTCCAGG - Intronic
1061345767 9:130023735-130023757 ACGTTTCCATGGGATCCTGTAGG - Intronic
1186398637 X:9235962-9235984 ATGTTTCCTCAGTCTCCTCTTGG - Intergenic
1188373092 X:29393042-29393064 AAGACTCCATAGGCTGCTGTGGG - Intronic
1188504511 X:30867160-30867182 ATGTCTCCTTAGACTCCTCTTGG - Exonic
1189076132 X:37916926-37916948 ATGTCTCCTTAGGCTCCTTTTGG + Intronic
1189138318 X:38573682-38573704 ATGTCTCCTTAGGCTCCCCTTGG + Intronic
1192226922 X:69235516-69235538 ATGTCTCCTTAGTCTCCTCTTGG + Intergenic
1192416690 X:70987396-70987418 ATGTCTCCTTAGGCTCCCCTTGG - Intergenic
1192557802 X:72104403-72104425 AAGTTTCATTAGGCTCCTGATGG + Intergenic
1192607902 X:72538978-72539000 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
1192734592 X:73837439-73837461 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1193039095 X:76985944-76985966 ATGTTTCCTTAGACTGCTCTTGG + Intergenic
1193198118 X:78657732-78657754 GAGTTTCCACAGGCCCCTATTGG - Exonic
1193419132 X:81262530-81262552 ATGTCTCCTTAGTCTCCTCTGGG - Intronic
1194063809 X:89237957-89237979 ATGTTTCCTTAGGTTACTCTTGG + Intergenic
1194162482 X:90471532-90471554 ATGTTTTCTTAGGCTCCTCTTGG - Intergenic
1194282002 X:91964336-91964358 AAGTTTGCATTGGCTAGTCTGGG - Intronic
1194589875 X:95786869-95786891 AGGTCTCCTTGGGCTCCTCTTGG + Intergenic
1196262063 X:113594567-113594589 ATGTTTCCTTAGGCTCCTCTTGG + Intergenic
1196614796 X:117755695-117755717 AAGTTTCCATTGCCTTATCTGGG - Intergenic
1198492824 X:137159868-137159890 ATGTTTCCTTAGACTTCTCTTGG - Intergenic
1198700476 X:139392217-139392239 GAATTCCCATAGGCTCTTCTAGG + Intergenic
1198857845 X:141036632-141036654 AAGTCTCCTTAGGCTCCTCTTGG + Intergenic
1198904851 X:141550740-141550762 AAGTCTCCTTAGGCTCCTCTTGG - Intergenic
1198955698 X:142127241-142127263 AAGATTCCTTTGGCTACTCTGGG + Intergenic
1199549702 X:149045332-149045354 ATGTCTCCTTAGGTTCCTCTTGG + Intergenic
1199584288 X:149397101-149397123 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1200508762 Y:4049272-4049294 ATGTTTTCTTAGGCTCCTCTTGG - Intergenic
1200599599 Y:5188996-5189018 AAGTTTGCATTGGCTAGTCTGGG - Intronic
1202386017 Y:24327035-24327057 AGGTTGCCATAGGGTTCTCTGGG - Intergenic
1202484769 Y:25343093-25343115 AGGTTGCCATAGGGTTCTCTGGG + Intergenic