ID: 1080820681

View in Genome Browser
Species Human (GRCh38)
Location 11:35803315-35803337
Sequence ACTTAGACTTACAACTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080820681_1080820688 27 Left 1080820681 11:35803315-35803337 CCACTCCAGTTGTAAGTCTAAGT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1080820688 11:35803365-35803387 TGATAAGTGGCTGAGGTAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 228
1080820681_1080820687 20 Left 1080820681 11:35803315-35803337 CCACTCCAGTTGTAAGTCTAAGT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1080820687 11:35803358-35803380 AGGAGCATGATAAGTGGCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 178
1080820681_1080820686 14 Left 1080820681 11:35803315-35803337 CCACTCCAGTTGTAAGTCTAAGT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1080820686 11:35803352-35803374 TTTCAGAGGAGCATGATAAGTGG 0: 1
1: 0
2: 0
3: 19
4: 200
1080820681_1080820685 0 Left 1080820681 11:35803315-35803337 CCACTCCAGTTGTAAGTCTAAGT 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1080820685 11:35803338-35803360 GTGACTGGCAGGTGTTTCAGAGG 0: 1
1: 0
2: 3
3: 9
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080820681 Original CRISPR ACTTAGACTTACAACTGGAG TGG (reversed) Intronic
907910610 1:58822704-58822726 ACTTTTATTTAGAACTGGAGGGG + Intergenic
909045434 1:70703945-70703967 ACTTAGAGTTTGAGCTGGAGTGG - Intergenic
911830526 1:102545370-102545392 TCATAGGCTTACAGCTGGAGAGG - Intergenic
915023807 1:152806841-152806863 ACTTAGAAATAGAAATGGAGTGG + Intronic
918641270 1:186843979-186844001 ACTTAGGAATACAAATGGAGAGG + Intronic
922165042 1:223108331-223108353 TATTAGACTTTCCACTGGAGGGG - Intergenic
922819346 1:228473406-228473428 ACTTGGATTTTCAACTGGACAGG + Intergenic
923911201 1:238445722-238445744 AATTAGACTTACGATTGGGGGGG - Intergenic
924275488 1:242382003-242382025 TCTTGGAGTTAGAACTGGAGAGG + Intronic
1065332793 10:24620306-24620328 AAACAGACTTACAAGTGGAGTGG - Exonic
1071228545 10:83560086-83560108 ACCAAAAATTACAACTGGAGAGG - Intergenic
1072424701 10:95320257-95320279 ACAGAGACTTAAATCTGGAGGGG - Intronic
1072694806 10:97595177-97595199 CCTTTGTCTTACAGCTGGAGGGG + Intronic
1074185588 10:111097469-111097491 CCTTAGACTTACCTTTGGAGTGG - Intergenic
1074227068 10:111494821-111494843 CCTTAGAATTCAAACTGGAGTGG + Intergenic
1075404255 10:122184025-122184047 ACTGATCCTTACAACAGGAGAGG - Intronic
1076194799 10:128509889-128509911 ATTTATACTTACAACTGTAAAGG - Intergenic
1080820681 11:35803315-35803337 ACTTAGACTTACAACTGGAGTGG - Intronic
1086161699 11:83728821-83728843 ACTTTAACTTACAACTGAACAGG + Intronic
1089899517 11:121966026-121966048 ACTTAGTCTCACAACTGATGAGG - Intergenic
1090902079 11:131041406-131041428 ACTTATTCTTAAAACTGGAAAGG - Intergenic
1094822116 12:34234112-34234134 ACTTTGACTTTCAACAGGGGAGG - Intergenic
1105942224 13:25157667-25157689 GCTTAGACTTACCAATGGATGGG + Intergenic
1106027786 13:25971777-25971799 ACATAGACTCACACATGGAGAGG + Intronic
1109003405 13:56835861-56835883 ACTTATACTTACAAAGGAAGTGG - Intergenic
1109530218 13:63632978-63633000 ACTTTGCCTTACAAGTGGGGAGG + Intergenic
1110248184 13:73351812-73351834 ACTTAGGCCTTCAACTGAAGGGG + Intergenic
1111182661 13:84688455-84688477 ACTTAGAGTTGACACTGGAGTGG + Intergenic
1116663818 14:47748998-47749020 ACATAGACTTTCAACTGCATTGG + Intergenic
1117523762 14:56577170-56577192 ATTTAGACATAGAAATGGAGAGG + Intronic
1120029697 14:79627072-79627094 ACTTAGAGTTACCAAGGGAGAGG - Intronic
1127143913 15:56005646-56005668 ACTTTGATTTACAACTGTACAGG + Intergenic
1142414219 16:89932629-89932651 ACTCGGACTTGCAGCTGGAGCGG + Exonic
1147541432 17:41363616-41363638 ACTCAGACTGACTACAGGAGAGG + Exonic
1149152601 17:53586642-53586664 ATTTAGAGTTACAAGTGGTGAGG + Intergenic
1153701341 18:7697029-7697051 ACTGAAACTAACATCTGGAGTGG + Intronic
1156583757 18:38409473-38409495 ACTTTTAGTTACAGCTGGAGTGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1168600750 19:57716474-57716496 AATAAGACTTAATACTGGAGGGG - Intronic
929332994 2:40707066-40707088 GCTCAGTCTTACAACTAGAGTGG - Intergenic
933398418 2:81761260-81761282 ACATAGACTCACAACTTCAGGGG - Intergenic
937276701 2:120689342-120689364 AATTGGACTTAGAACTGGTGTGG - Intergenic
939825935 2:147015592-147015614 ACATGGATTTTCAACTGGAGTGG + Intergenic
941135526 2:161713163-161713185 ACTTAGACTTACCACAGGAAAGG + Intronic
1171511762 20:25691587-25691609 CCATAGACTGAGAACTGGAGAGG + Intronic
1175659065 20:60796694-60796716 ACTTAGATAGACACCTGGAGGGG - Intergenic
1183398510 22:37587283-37587305 GCTCAGACTTGCAACTGGTGTGG + Intergenic
950987265 3:17387859-17387881 ATTTAGAATTAAAACTGTAGAGG + Intronic
951673112 3:25206884-25206906 CCTGTGACTGACAACTGGAGAGG - Intronic
963614711 3:147521610-147521632 ACATATAATTATAACTGGAGAGG - Intergenic
966041996 3:175502791-175502813 ACATAGGTTTACAGCTGGAGAGG + Intronic
966813420 3:183868702-183868724 ACTGAAACTGACAACTGGTGGGG - Intronic
967120083 3:186374929-186374951 ACTTAAACTTCCAAATGAAGTGG - Intergenic
971158476 4:24108411-24108433 ACTTAATCTTAGAACTAGAGTGG - Intergenic
972863350 4:43200030-43200052 GCTCAGATTTAGAACTGGAGAGG - Intergenic
974178007 4:58348879-58348901 ACTTCCTCTTACAACTGCAGAGG + Intergenic
975770794 4:77720367-77720389 ACTTTGATTTACAACTGTACAGG + Exonic
978702659 4:111667669-111667691 GCTTAGGCTTAAAACTGGAATGG - Intergenic
978951346 4:114562862-114562884 ACTTATATTTACAATTGCAGTGG + Intergenic
981404771 4:144355409-144355431 ACTAAGACTTACAAGGGGAATGG + Intergenic
986178234 5:5369832-5369854 ACTCAGAGTTCCAACTGGACAGG + Intergenic
986242701 5:5975604-5975626 ACCTGGAATTACGACTGGAGAGG - Intergenic
987085974 5:14468132-14468154 ACGTGGACTTCCAAATGGAGAGG + Intronic
989399531 5:40993911-40993933 ACTTACAATTACCACGGGAGGGG + Intergenic
989948240 5:50265618-50265640 ACTTAGATTTTCAACTGTACAGG + Intergenic
990969844 5:61493119-61493141 ACTTAAAGTTCCAACTTGAGAGG + Intronic
992734718 5:79707236-79707258 ACTGAGACATACAACTGGAACGG + Intronic
994584988 5:101695620-101695642 ACCAAGAGTTAGAACTGGAGAGG - Intergenic
994585042 5:101696698-101696720 ACCAAGAGTTAGAACTGGAGAGG + Intergenic
997716698 5:136047961-136047983 CATTTGTCTTACAACTGGAGGGG + Intronic
998421203 5:141988192-141988214 ACTATTCCTTACAACTGGAGTGG + Exonic
998484533 5:142490239-142490261 ACTTAAAGTTAGAACTGAAGAGG - Intergenic
1004691188 6:17993381-17993403 ACTTAGTCTTACATCTGAAATGG - Intergenic
1010791329 6:80068568-80068590 AAACAGACTTACAAGTGGAGTGG - Intergenic
1012542467 6:100377543-100377565 ACCTAGAGTTACATCTGGTGTGG + Intergenic
1014268613 6:119311427-119311449 ACATTGCCTTACACCTGGAGAGG - Intronic
1018692237 6:166356099-166356121 ATTTTGACTTACAAGTGAAGAGG + Intergenic
1021342706 7:19484707-19484729 ATTTATATTTACAACTGCAGAGG + Intergenic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1028211951 7:88084457-88084479 AGTTAGATTTTCAAATGGAGTGG - Intronic
1035141741 7:156769336-156769358 CCTTCGTCTTACAACAGGAGAGG + Intronic
1038264007 8:26022904-26022926 ACCTAGAGTTGCAGCTGGAGGGG - Intronic
1047130219 8:122010982-122011004 ACTGAGGCTTACAATTGGATTGG + Intergenic
1047283511 8:123466138-123466160 TCTGAGAATTACAACTGGAGAGG + Intronic
1050027133 9:1347082-1347104 ACTAAGAGTTAGAATTGGAGGGG + Intergenic
1050437722 9:5628293-5628315 ACTTAGTTTTAGAACTGGAAGGG - Intergenic
1056037531 9:82623024-82623046 ACTTAGAGTTGATACTGGAGTGG + Intergenic
1056666511 9:88585065-88585087 ACTTAGAAATACAACAGGAGAGG - Intergenic
1062336543 9:136072891-136072913 ACTTAAACATAAAACTAGAGGGG + Intronic
1188128467 X:26400058-26400080 TCATAGACTCACAGCTGGAGGGG + Intergenic
1188268281 X:28105751-28105773 ACTTAGACTTAAAAATTGAAGGG - Intergenic
1201767880 Y:17589582-17589604 ACTTTGACTTGCAATGGGAGAGG - Intergenic
1201833673 Y:18316403-18316425 ACTTTGACTTGCAATGGGAGAGG + Intergenic