ID: 1080821014

View in Genome Browser
Species Human (GRCh38)
Location 11:35806580-35806602
Sequence TTCCTTGACCTACCACAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080821014_1080821015 0 Left 1080821014 11:35806580-35806602 CCTGGTTGTGGTAGGTCAAGGAA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1080821015 11:35806603-35806625 AAGAGCCCCTTTGATCCACCAGG 0: 1
1: 0
2: 0
3: 1
4: 76
1080821014_1080821022 24 Left 1080821014 11:35806580-35806602 CCTGGTTGTGGTAGGTCAAGGAA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1080821022 11:35806627-35806649 GCAATTAAGAAAGGTCCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 159
1080821014_1080821020 15 Left 1080821014 11:35806580-35806602 CCTGGTTGTGGTAGGTCAAGGAA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1080821020 11:35806618-35806640 CCACCAGGAGCAATTAAGAAAGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080821014 Original CRISPR TTCCTTGACCTACCACAACC AGG (reversed) Exonic
901615978 1:10540057-10540079 TTCATTTGCCTACCCCAACCAGG - Intronic
909259608 1:73470294-73470316 TTCATTGACTTAGCATAACCTGG - Intergenic
919377349 1:196810284-196810306 TTCTTTGTCCTACCACCACTGGG - Intergenic
919389648 1:196966203-196966225 TTCTTTGTCCTACCACCACTGGG - Intergenic
1068577287 10:58698490-58698512 TTCCTTGACTACCCACGACCGGG + Intronic
1070916866 10:80160725-80160747 CTCCCTTACCTTCCACAACCAGG + Intronic
1072574192 10:96685380-96685402 TTTCTTGCCCAACCACAGCCTGG - Intronic
1076480794 10:130784056-130784078 TTATTTGAGCTGCCACAACCAGG + Intergenic
1077309578 11:1882423-1882445 TCCCTTGTCCTCCTACAACCAGG + Intronic
1080821014 11:35806580-35806602 TTCCTTGACCTACCACAACCAGG - Exonic
1083171221 11:60924920-60924942 TTCCTTCACCTTGCACGACCCGG + Intronic
1084388416 11:68859259-68859281 TTCCGATACATACCACAACCTGG - Intergenic
1084490359 11:69475143-69475165 CTCCTTGACCTACCCCTCCCTGG - Intergenic
1088415537 11:109584824-109584846 TTCATTGACTTAACACATCCTGG - Intergenic
1088840845 11:113626469-113626491 TGCCTTGAGCTACCAGAAGCTGG - Intergenic
1089535181 11:119156647-119156669 TTGCCCCACCTACCACAACCCGG + Exonic
1090665834 11:128914413-128914435 CTCCTTCCCCTCCCACAACCCGG + Intronic
1090952238 11:131483840-131483862 TTCCTTGTCCTGCCTCTACCTGG - Intronic
1091548077 12:1517779-1517801 TGCCTCCACCTACCACAAACTGG - Intergenic
1093414122 12:18900709-18900731 TTCCTTGATGAACCACAACATGG + Intergenic
1094133182 12:27097022-27097044 TGCCTTGACCTCCCAGAAACTGG - Intergenic
1094183004 12:27612233-27612255 TACCTTGACCTCCCAGAAACTGG - Intronic
1096535134 12:52267200-52267222 CTCCCTGACTGACCACAACCAGG - Intronic
1097387404 12:58965413-58965435 TTCCTCGAATTTCCACAACCAGG + Intergenic
1103111380 12:118282077-118282099 TTCCTTGATCTACAGTAACCTGG + Intronic
1103316740 12:120062375-120062397 TCTCTTCACCTTCCACAACCAGG - Intronic
1104879613 12:132061519-132061541 TTCCTTGTCCCACCATAAACTGG - Intronic
1105825534 13:24119287-24119309 TTCCTGGGCCCACCACAAACTGG - Intronic
1106083172 13:26517264-26517286 TTCCTTGATTTACCCCAGCCTGG - Intergenic
1107415225 13:40193763-40193785 TTCCTTGACAAACCAGAACAGGG + Intergenic
1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG + Intronic
1117054464 14:51897692-51897714 TTCCTTGCCCTCCCAGAACCAGG - Intronic
1119722265 14:76899219-76899241 TCCCTTTACCTGCCACAATCTGG - Intergenic
1125218987 15:37311356-37311378 TTCCTTCCCCTACCAGAACCAGG - Intergenic
1128128565 15:65210697-65210719 TTCCCTTTCCTACCACACCCTGG - Intronic
1130361246 15:83188496-83188518 TACCTTGGCCTCCCAAAACCTGG + Intronic
1130891024 15:88133974-88133996 TTCCTGGAGCTGCCACACCCTGG + Intronic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1135413306 16:22250909-22250931 TCCCTTGACCTCCCAACACCAGG - Intronic
1137410245 16:48222175-48222197 TGCCTTGGCCTTCCACAACTGGG + Intronic
1138560844 16:57800243-57800265 TTCCTTGACTTAGAACAACTAGG + Intronic
1138791269 16:59906806-59906828 TTCCTTGACCTCCCAAAAGCTGG + Intergenic
1141889180 16:86915209-86915231 TTCCTTGACTTGGCACAGCCGGG - Intergenic
1142369585 16:89670843-89670865 TTCCGTGGCCTTCCACAATCAGG - Intronic
1143901117 17:10175626-10175648 TTCCTTGACCTACAACAGTGTGG + Intronic
1150722448 17:67625237-67625259 CTCCGTGACCTCCCACACCCAGG + Intronic
1152635726 17:81429818-81429840 TTCCTGGGGCTACCCCAACCTGG - Intronic
1153757657 18:8300295-8300317 GTCCTTGTCCTACCACATACTGG + Intronic
1156020950 18:32598416-32598438 TTCCATTACCTACTACACCCTGG + Intergenic
1157385992 18:47260479-47260501 TTCCTTCACCTGCCAGGACCGGG + Intergenic
1160091263 18:75828836-75828858 TTCCTTCAACTTCTACAACCTGG + Intergenic
1163432579 19:17277018-17277040 TGCCATGACCTACCCCAACCAGG - Intronic
929231816 2:39567929-39567951 TTCCTTGAGCTCCCAGAAGCTGG - Intergenic
934544720 2:95205478-95205500 CTCCCTGACCTACTAAAACCAGG - Intergenic
936285880 2:111181042-111181064 TTCCTGGACCCACCAGAAGCTGG - Intergenic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
938637041 2:133239420-133239442 TTCCGTGAAATACCACAACATGG + Intronic
947079429 2:226379659-226379681 TTCCTTGAGCTACATCATCCAGG + Intergenic
948908049 2:240989198-240989220 TTCCTCGCCCTAACACAAGCAGG - Intronic
1173092300 20:39984853-39984875 TTCCATCCCCTACCACAGCCTGG + Intergenic
1178938270 21:36882917-36882939 CTCCTTGCCCTTCCACAACCAGG + Intronic
1182767972 22:32772438-32772460 TTCCTTGTCCTTCCAGAACAAGG + Intronic
1183135891 22:35887365-35887387 TTCCTTGCCCTCCCACGCCCTGG + Intronic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
955935073 3:64095231-64095253 TTCCTCGAGCCTCCACAACCTGG + Exonic
958194770 3:90230241-90230263 TTTATTGTCATACCACAACCTGG - Intergenic
960725122 3:120662360-120662382 TTCCTTTTCCTACCTCCACCTGG - Intronic
964631846 3:158818988-158819010 TTCACTGCCCTACCACAGCCCGG - Intronic
965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG + Intergenic
970298736 4:14659546-14659568 TTCCTTGACTAACCAAAACGTGG + Intergenic
975240863 4:72057430-72057452 TTCCTGGAGCCACCACAAGCTGG - Intronic
975885603 4:78961035-78961057 TTTGTTGACCTACCACATGCAGG + Intergenic
976009247 4:80467530-80467552 TTCCTTGCCTTGCCCCAACCTGG + Intronic
977547488 4:98401134-98401156 TTTTTTGACCTAACCCAACCTGG - Intronic
981876916 4:149558053-149558075 TTCCTTGATCTAGCACATTCTGG + Intergenic
982659295 4:158187816-158187838 TTCCTGGAAGTACCACAAACTGG - Intergenic
983066967 4:163222291-163222313 CTCCTTGACCTACCAGAATTAGG - Intergenic
983956496 4:173704512-173704534 TTCCTGGCCCTACCACACGCTGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
987265268 5:16246797-16246819 TTCCTTGTTCTACCACCAACTGG + Intergenic
989985135 5:50688240-50688262 TTCCTTGACCTTGGAAAACCAGG + Intronic
995113185 5:108450463-108450485 CTCCTTGACCCACCACAAAGTGG - Intergenic
1000175371 5:158747105-158747127 TTCCTTCAGCAAACACAACCAGG + Intronic
1002448326 5:179303567-179303589 ATCCTTGAGCTACAACAACAGGG - Intronic
1003226363 6:4209474-4209496 CTCCTTGACTTACCAAAACTAGG - Intergenic
1008461763 6:51783191-51783213 TTCTTTGGCCTGTCACAACCAGG - Intronic
1011156556 6:84340338-84340360 ATCCTTGAGCACCCACAACCAGG - Intergenic
1012371116 6:98508527-98508549 TTACCTTACCTACCACAAACTGG + Intergenic
1013261077 6:108443123-108443145 ATCCTTGACCTACAGAAACCAGG - Intronic
1014007223 6:116433479-116433501 TTCCTGGACCTTCCACCACACGG - Exonic
1017102792 6:150863501-150863523 TTTCGTGACCTGCCACAACGTGG + Intergenic
1017813326 6:157999714-157999736 TTCCTTGCCCTCCCAAACCCTGG - Intronic
1018509459 6:164509842-164509864 TTCCTTCCCCCACCACAATCTGG - Intergenic
1022479883 7:30735929-30735951 CTCCTTGCCCCACCACACCCAGG - Intronic
1032210265 7:129907503-129907525 TGCTTTTATCTACCACAACCCGG - Intronic
1042862981 8:73332315-73332337 TTCCTACACATACCACAACAAGG + Intergenic
1045208727 8:100071946-100071968 TGCCTTGGCCTCCCAAAACCTGG - Intronic
1047248071 8:123161257-123161279 TTCCTTGCCCTACGTCAGCCGGG + Intergenic
1053202542 9:36162573-36162595 TGCCTAGAACCACCACAACCTGG + Exonic
1054883054 9:70165225-70165247 TTCTTTGTCCTGCCTCAACCAGG + Intronic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1186402513 X:9272824-9272846 TTGCTTGACCTTCCAACACCTGG - Intergenic
1187165009 X:16796818-16796840 TTCCTGCTCCCACCACAACCAGG + Intronic
1188055155 X:25532007-25532029 TTCCAGGACAAACCACAACCTGG + Intergenic
1192900084 X:75487139-75487161 TTCCATGTCCTACAACACCCTGG + Intronic
1198591746 X:138190703-138190725 TTCCATGCCCTCCCTCAACCAGG - Intergenic
1199264329 X:145812797-145812819 TTACCTGACCTACCATAATCAGG + Intergenic