ID: 1080821018

View in Genome Browser
Species Human (GRCh38)
Location 11:35806610-35806632
Sequence AATTGCTCCTGGTGGATCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080821018_1080821027 28 Left 1080821018 11:35806610-35806632 CCTTTGATCCACCAGGAGCAATT 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1080821027 11:35806661-35806683 TGGCTGCTTTGAACTTACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1080821018_1080821022 -6 Left 1080821018 11:35806610-35806632 CCTTTGATCCACCAGGAGCAATT 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1080821022 11:35806627-35806649 GCAATTAAGAAAGGTCCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 159
1080821018_1080821023 8 Left 1080821018 11:35806610-35806632 CCTTTGATCCACCAGGAGCAATT 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1080821023 11:35806641-35806663 TCCTTCAGGTAATCCCTCAATGG 0: 1
1: 1
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080821018 Original CRISPR AATTGCTCCTGGTGGATCAA AGG (reversed) Exonic
900636689 1:3669467-3669489 AAGAGCTCCTGGTGGGTCCAAGG - Intronic
904919126 1:33992920-33992942 CATTCTTCCTGGTGGATCTATGG - Intronic
905036537 1:34922039-34922061 AGTTGGTCCTAGTGGATGAAAGG - Intronic
906892727 1:49735453-49735475 CATTTCTTCTGGAGGATCAATGG - Intronic
907097414 1:51794309-51794331 AATTGCTCCTGTTGGTAAAATGG - Intronic
907455833 1:54574934-54574956 AATTGCTGCATGTGGATGAAAGG - Intronic
921778702 1:219134084-219134106 AGTAGCTCCTGGTGTGTCAAAGG + Intergenic
922349776 1:224725775-224725797 TAATGCTCCTGGTGGAGAAAAGG - Intronic
923988306 1:239406427-239406449 TATAGCTGATGGTGGATCAAGGG - Intronic
924618671 1:245639722-245639744 ACATGCTCCTGGATGATCAATGG - Intronic
1068753887 10:60628439-60628461 AATTGCTCCTGGATGATCATGGG - Intronic
1074271227 10:111955707-111955729 AAGAGCTCCAGGTGGATGAAAGG + Intergenic
1075490108 10:122859479-122859501 TCTTGATCCTGGAGGATCAAAGG + Intronic
1080821018 11:35806610-35806632 AATTGCTCCTGGTGGATCAAAGG - Exonic
1081524084 11:43912220-43912242 ATTTGCTTCTGTTGGAACAAAGG + Intronic
1091446632 12:547367-547389 AAGTGCTCCAGGTGGGTGAAGGG + Intronic
1093324185 12:17753664-17753686 AATTGCTGCTGATGTACCAAAGG - Intergenic
1093399503 12:18727416-18727438 AATTCTTCCTGGAGGGTCAAAGG + Intronic
1094025152 12:25954225-25954247 CAGTGCTCCTGGGGGATCACTGG + Intergenic
1097564741 12:61253154-61253176 AATTGCTTCTGGTGGGCCTATGG + Intergenic
1098160342 12:67643463-67643485 CATTTGTCCTGCTGGATCAAAGG + Intergenic
1104613379 12:130248594-130248616 AGTAGCTCCTGGTGGAGCACTGG - Intergenic
1107059273 13:36138906-36138928 AATAGATCTTGCTGGATCAAAGG - Intergenic
1110539450 13:76691259-76691281 AATTTCTCTTGGTGCAGCAAAGG + Intergenic
1110865724 13:80393360-80393382 AATTCCTTCTGGAGGCTCAAGGG - Intergenic
1115922271 14:38388988-38389010 AATAGCTCCTCGTGGATCAATGG + Intergenic
1116308125 14:43284162-43284184 AATTGCTTCTGGTGGCCCTATGG + Intergenic
1123677918 15:22730472-22730494 AATTGCTGCTGGAAGATTAAGGG - Intergenic
1124330116 15:28804739-28804761 AATTGCTGCTGGAAGATTAAGGG - Intergenic
1126680740 15:51199703-51199725 AATGGCTCCTGGAGGATGAGAGG - Intergenic
1128368208 15:67019795-67019817 AGTTGCTCCAGGTGGATCTGGGG - Intergenic
1133076781 16:3285974-3285996 AATTGTTCTTGGTGCATCAGGGG + Intronic
1133779090 16:8922941-8922963 AATTAAGCCTGGTGGCTCAATGG + Intronic
1138663119 16:58537983-58538005 AAATCCTGCTGGTGGATGAAAGG - Exonic
1148380218 17:47191170-47191192 TATTCCTCCTGGTGAATCCAGGG - Intergenic
1149621360 17:58047694-58047716 AATTCCTTCTGGTGTATCCAAGG + Intergenic
1151807543 17:76415469-76415491 AATTGGTCCAGGTGTAGCAAGGG - Intronic
1154411152 18:14142934-14142956 AATGGCTCTTGGAGGCTCAAGGG + Intergenic
1155537342 18:26831219-26831241 AATTGCTCCTGCTGAGGCAATGG + Intergenic
1155590296 18:27419934-27419956 ATTTGCTCCTTCTGGATGAAAGG - Intergenic
1157366197 18:47066460-47066482 AATTGCTCCTGCTGGAAGTAGGG + Intronic
1158308649 18:56134923-56134945 AATTGGTCTAGGTGTATCAATGG + Intergenic
1160085524 18:75773748-75773770 AATTGTTTCTGGTGGAGAAATGG + Intergenic
1167716550 19:51146020-51146042 AAGTGCACCTGGGGGATGAAGGG + Exonic
926895064 2:17677785-17677807 AATTTCTACTGGTAGATCATGGG - Intronic
927850977 2:26499120-26499142 AGATGTTCTTGGTGGATCAAGGG - Intronic
932760842 2:74438329-74438351 AAATGCTCATGGTGGAGAAAGGG - Intronic
937203944 2:120223797-120223819 AACTCCGCCTGGTGGAGCAACGG + Intergenic
938230151 2:129651356-129651378 ATTTTCTCCTGGTGGCTCCAGGG - Intergenic
938664554 2:133521009-133521031 AATTTATCCAAGTGGATCAAAGG + Intronic
941966076 2:171302530-171302552 AACTGCTCTTGTTGGAACAATGG - Intergenic
945164949 2:206933227-206933249 AATTGATCCTGCTGCATAAAGGG + Intergenic
946744131 2:222829091-222829113 AGTTCCTCCAGGTGGAACAATGG - Intergenic
946814686 2:223564832-223564854 AATAGCTTCTGTTGAATCAAAGG + Intergenic
947170258 2:227303889-227303911 AATTGGTCCTGGAGGTCCAATGG - Exonic
948614056 2:239187042-239187064 GAATGCTCCAGGTGGATCAACGG + Intronic
948721261 2:239901973-239901995 AATTGCTTCTTGTGGATGAGCGG + Intronic
1174116795 20:48231752-48231774 ACTTGCTCTTGGTGAATCATGGG - Intergenic
1175819905 20:61903602-61903624 AATTGCTCATGGTAGAAAAATGG - Intronic
1176662326 21:9649201-9649223 GGCTGCTCCTGGTGGCTCAATGG - Intergenic
1176861903 21:14015481-14015503 AATGGCTCTTGGAGGCTCAAGGG - Intergenic
1177297439 21:19194827-19194849 AATTGCCCTTGTTTGATCAAAGG - Intergenic
1183351622 22:37337748-37337770 AATTGCTCCTCCTGGTTCCATGG + Intergenic
951716251 3:25650142-25650164 AATTGCTCTTGTTTGATGAAAGG + Intronic
952488578 3:33841908-33841930 AATTGCTGCTGGAAGATTAAGGG - Exonic
952577968 3:34797496-34797518 AATTGCTCCTGGAGGCAGAAAGG + Intergenic
952992287 3:38842325-38842347 GATTACTCCTTGTGTATCAAGGG + Intergenic
955630958 3:60974437-60974459 AATTGCTGCTGGTTGGTAAAGGG + Intronic
956923460 3:73955917-73955939 AATTGCTCATTGTCCATCAATGG + Intergenic
958451096 3:94273514-94273536 AGTTGCTCTTGGTGGGTCAGTGG + Intergenic
959810684 3:110615616-110615638 AATAGCTCCTGTTGGACAAATGG + Intergenic
961763767 3:129191779-129191801 AACTGCTCCTTGTGGAGCAGGGG - Intergenic
962587466 3:136856881-136856903 AATTGCTGCTGCTGGAGCAAAGG - Intergenic
964848459 3:161068828-161068850 AATGGCTCCTGGAGGGTCCAGGG + Exonic
970374414 4:15442280-15442302 AATTGGTCCTCCTGGACCAAAGG + Exonic
972313704 4:37905519-37905541 AATTGCTCCTGTTTGATGAGAGG + Intronic
973975043 4:56254764-56254786 AATAGTTCCTGCTGGATAAAAGG - Intronic
978152289 4:105451132-105451154 AATTGCTCTGGGTGGAGCCAGGG + Intronic
978700285 4:111635326-111635348 TATTCTTACTGGTGGATCAAAGG - Intergenic
980983410 4:139672958-139672980 TATTGATCCTGGTGTAGCAAGGG - Intronic
982011734 4:151112291-151112313 ACTTGCACCTGTTGGGTCAATGG + Intronic
982203933 4:152983049-152983071 AATGGCTCCTGGGGGAACATTGG + Intergenic
984680365 4:182601196-182601218 AATTGCTCCTGGTGAGAAAAGGG - Intronic
984975492 4:185226983-185227005 AAATGGTCCTGGAGGCTCAATGG - Intronic
984994450 4:185415502-185415524 ATTTGCTCTTTGTGGATAAAGGG + Intronic
985413066 4:189707325-189707347 GGCTGCTCCTGGTGGCTCAATGG + Intergenic
986156901 5:5184877-5184899 AATTACCCCTGGTGGAAAAATGG - Intronic
986647238 5:9929482-9929504 AAATGCTCTCTGTGGATCAATGG - Intergenic
990033803 5:51294740-51294762 CATTGGACCTGGTGGCTCAAAGG - Intergenic
995267568 5:110181178-110181200 AATTGCTCTTGCTAGATCAATGG + Intergenic
997652854 5:135535229-135535251 CACTGCGCCTGGCGGATCAAGGG - Exonic
997941955 5:138165953-138165975 AGAGGCTCCTGTTGGATCAAAGG - Exonic
1000952537 5:167501631-167501653 TATTGCTCCTGATGGTTCAGTGG - Intronic
1004450908 6:15745357-15745379 AATTGCAGCTAGTGGACCAAGGG + Intergenic
1008007367 6:46425104-46425126 GATCGCTCCTGGTGGATGACAGG - Intronic
1010393850 6:75368192-75368214 AACTGCACCAGGTGGAACAAGGG + Intronic
1010546098 6:77158392-77158414 ACTTGATCATGGTGGATAAATGG - Intergenic
1013011969 6:106128882-106128904 AATTCTTTCTGGTGGATCAGAGG - Intergenic
1015363758 6:132373648-132373670 AATCTCTCCTGGTTGCTCAATGG - Intronic
1015673945 6:135723800-135723822 AATTTCTCTTGGGGGGTCAAAGG - Intergenic
1018291018 6:162292725-162292747 AACTGATCCTGGTGGGTCTAAGG - Intronic
1018997631 6:168722351-168722373 AATTGCTCATGGAGTATAAAAGG + Intergenic
1023729223 7:43174264-43174286 CATTGCTACTGGAGGATCCATGG + Intronic
1025248663 7:57337151-57337173 AATTGAAACTGATGGATCAATGG - Intergenic
1027702618 7:81486949-81486971 AATGGCTCCTAGTGGATGAGAGG + Intergenic
1031814783 7:126420353-126420375 AATGGTTCCTGGTGCATCACTGG + Intergenic
1036203463 8:6788160-6788182 AATTGCTCCTGGTGGAGGTCTGG - Intergenic
1043679789 8:83009299-83009321 ATTAGCTCATGGTGGATCCATGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050210887 9:3254800-3254822 AAATCCTCCTGCTGTATCAAGGG + Intronic
1051474069 9:17483433-17483455 AATTGAAACTGCTGGATCAAAGG - Intronic
1059718784 9:116938442-116938464 CAGTGCTCCTTGTGGACCAAAGG - Intronic
1060402614 9:123357238-123357260 AATTCCTCCTGGGGGGTCCAAGG + Intronic
1185985126 X:4824288-4824310 ATTTGCTCCTGGAGGCTGAAGGG + Intergenic
1186295728 X:8145592-8145614 AATTTCTTCTGGAGGCTCAAAGG + Intergenic
1186767900 X:12790544-12790566 TATTGCTCTTGGTGGCTCACTGG - Intergenic
1187235674 X:17464844-17464866 CATGGCTGCTGGTGGACCAAAGG - Intronic
1192003534 X:67183311-67183333 AATTGCTCTTGTTTGATAAAAGG + Intergenic
1195635847 X:107115054-107115076 ACTAACTCCTGATGGATCAATGG - Intronic
1197380100 X:125728626-125728648 AATTGCTTCTGGTGGACCTTAGG + Intergenic
1198500542 X:137241311-137241333 AATTGCTCTTGCTCGATCAGAGG + Intergenic