ID: 1080823997

View in Genome Browser
Species Human (GRCh38)
Location 11:35832601-35832623
Sequence GAGAGCTCCCTTACCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080823990_1080823997 16 Left 1080823990 11:35832562-35832584 CCACCTCAAAAAAACAAACAAAC 0: 15
1: 600
2: 2049
3: 8572
4: 120568
Right 1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG No data
1080823991_1080823997 13 Left 1080823991 11:35832565-35832587 CCTCAAAAAAACAAACAAACAAA 0: 64
1: 325
2: 1445
3: 9474
4: 32673
Right 1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080823997 Original CRISPR GAGAGCTCCCTTACCTCTTC TGG Intergenic
No off target data available for this crispr