ID: 1080824281

View in Genome Browser
Species Human (GRCh38)
Location 11:35834865-35834887
Sequence GTGAGCAGGGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080824281_1080824290 -4 Left 1080824281 11:35834865-35834887 CCCTCCACCTTCCCCCTGCTCAC No data
Right 1080824290 11:35834884-35834906 TCACTGCTGTCTGGTCATGCTGG No data
1080824281_1080824291 4 Left 1080824281 11:35834865-35834887 CCCTCCACCTTCCCCCTGCTCAC No data
Right 1080824291 11:35834892-35834914 GTCTGGTCATGCTGGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080824281 Original CRISPR GTGAGCAGGGGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr