ID: 1080829389

View in Genome Browser
Species Human (GRCh38)
Location 11:35877208-35877230
Sequence GCCTCAACTTTGCTGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080829384_1080829389 0 Left 1080829384 11:35877185-35877207 CCAGTTCTTCACCACTCCCTGCA No data
Right 1080829389 11:35877208-35877230 GCCTCAACTTTGCTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080829389 Original CRISPR GCCTCAACTTTGCTGTGGCC AGG Intergenic
No off target data available for this crispr