ID: 1080831291

View in Genome Browser
Species Human (GRCh38)
Location 11:35895630-35895652
Sequence TTCCAAAGTGTTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 746881
Summary {0: 978, 1: 32713, 2: 325405, 3: 254412, 4: 133373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080831291_1080831303 26 Left 1080831291 11:35895630-35895652 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1080831303 11:35895679-35895701 CCAGGAATTCAAGACCAGCCTGG 0: 1413
1: 22759
2: 95221
3: 162970
4: 182028
1080831291_1080831300 3 Left 1080831291 11:35895630-35895652 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1080831300 11:35895656-35895678 CAAGGTGGGCGGATCATGTGAGG 0: 6
1: 223
2: 4890
3: 27328
4: 64430
1080831291_1080831301 8 Left 1080831291 11:35895630-35895652 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1080831301 11:35895661-35895683 TGGGCGGATCATGTGAGGCCAGG No data
1080831291_1080831299 -8 Left 1080831291 11:35895630-35895652 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080831291 Original CRISPR TTCCAAAGTGTTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr