ID: 1080831299

View in Genome Browser
Species Human (GRCh38)
Location 11:35895645-35895667
Sequence CTTTGGAAGGGCAAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080831291_1080831299 -8 Left 1080831291 11:35895630-35895652 CCTGTAATCCCAACACTTTGGAA 0: 978
1: 32713
2: 325405
3: 254412
4: 133373
Right 1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080831299 Original CRISPR CTTTGGAAGGGCAAGGTGGG CGG Intergenic
No off target data available for this crispr