ID: 1080831528

View in Genome Browser
Species Human (GRCh38)
Location 11:35897588-35897610
Sequence CTAAGGTTCTTCCATTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080831523_1080831528 15 Left 1080831523 11:35897550-35897572 CCACCCGGGCGGAGGGAGATAAG No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data
1080831520_1080831528 22 Left 1080831520 11:35897543-35897565 CCAAAACCCACCCGGGCGGAGGG No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data
1080831522_1080831528 16 Left 1080831522 11:35897549-35897571 CCCACCCGGGCGGAGGGAGATAA No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data
1080831524_1080831528 12 Left 1080831524 11:35897553-35897575 CCCGGGCGGAGGGAGATAAGTGG No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data
1080831526_1080831528 11 Left 1080831526 11:35897554-35897576 CCGGGCGGAGGGAGATAAGTGGA No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data
1080831517_1080831528 26 Left 1080831517 11:35897539-35897561 CCTACCAAAACCCACCCGGGCGG No data
Right 1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080831528 Original CRISPR CTAAGGTTCTTCCATTGTCC AGG Intergenic
No off target data available for this crispr