ID: 1080833851

View in Genome Browser
Species Human (GRCh38)
Location 11:35921459-35921481
Sequence GGCAAATTGCCAAGTTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080833851_1080833855 26 Left 1080833851 11:35921459-35921481 CCTTCACAACTTGGCAATTTGCC No data
Right 1080833855 11:35921508-35921530 ACTTTAAATCTCTTTATTTAAGG No data
1080833851_1080833856 27 Left 1080833851 11:35921459-35921481 CCTTCACAACTTGGCAATTTGCC No data
Right 1080833856 11:35921509-35921531 CTTTAAATCTCTTTATTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080833851 Original CRISPR GGCAAATTGCCAAGTTGTGA AGG (reversed) Intergenic
No off target data available for this crispr