ID: 1080835792

View in Genome Browser
Species Human (GRCh38)
Location 11:35939721-35939743
Sequence TCTGACAAACAGTTATTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080835792_1080835796 30 Left 1080835792 11:35939721-35939743 CCAGACAATAACTGTTTGTCAGA No data
Right 1080835796 11:35939774-35939796 CTTCATACAACAACCCTACAAGG No data
1080835792_1080835794 -3 Left 1080835792 11:35939721-35939743 CCAGACAATAACTGTTTGTCAGA No data
Right 1080835794 11:35939741-35939763 AGATAAATAAAGGAATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080835792 Original CRISPR TCTGACAAACAGTTATTGTC TGG (reversed) Intergenic
No off target data available for this crispr