ID: 1080836480

View in Genome Browser
Species Human (GRCh38)
Location 11:35944806-35944828
Sequence CCCAGGGCCCCTCGCCGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080836480_1080836489 0 Left 1080836480 11:35944806-35944828 CCTGACCGGCGAGGGGCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1080836489 11:35944829-35944851 AGAGGACACGGGGCTTCATCCGG 0: 1
1: 0
2: 2
3: 18
4: 193
1080836480_1080836491 17 Left 1080836480 11:35944806-35944828 CCTGACCGGCGAGGGGCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1080836491 11:35944846-35944868 ATCCGGCGGCCCTTTGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 29
1080836480_1080836490 3 Left 1080836480 11:35944806-35944828 CCTGACCGGCGAGGGGCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1080836490 11:35944832-35944854 GGACACGGGGCTTCATCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 55
1080836480_1080836486 -10 Left 1080836480 11:35944806-35944828 CCTGACCGGCGAGGGGCCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1080836486 11:35944819-35944841 GGGCCCTGGGAGAGGACACGGGG 0: 1
1: 0
2: 4
3: 46
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080836480 Original CRISPR CCCAGGGCCCCTCGCCGGTC AGG (reversed) Intronic
900349413 1:2227696-2227718 CCCAGCGGCCCTCGGCGGGCGGG + Intergenic
900715364 1:4140568-4140590 CCCAAGGCCCCTTGCAGCTCAGG - Intergenic
901441575 1:9281491-9281513 CCCAGGGCTCCTGGCCTGGCGGG + Intergenic
901644649 1:10709918-10709940 CCCACCGCCCCTCCCTGGTCCGG - Intronic
902527557 1:17069026-17069048 GCCAGGGCCCCTGGCAGGTCAGG + Exonic
902870857 1:19312662-19312684 GCGAGGGCCCCTCGCCCGGCCGG - Exonic
903338795 1:22641904-22641926 CCCAGGGCCCTTCCCCTTTCTGG - Intergenic
904429200 1:30451127-30451149 CCCAGGGCCTCTGGCCAATCAGG - Intergenic
904652386 1:32014799-32014821 CCCACGGTCCCTCCCCGCTCTGG - Intronic
905092540 1:35441033-35441055 CCCAGGGCCCCTACCTGCTCGGG + Exonic
907689153 1:56645263-56645285 CCCCGCGCCCCTCGCGGCTCGGG + Intronic
912485219 1:110021569-110021591 TCCAGGGCCCCTCCCCAGCCTGG - Intronic
913450548 1:118989777-118989799 CCCTGGGCCCCTCCGCAGTCCGG - Intergenic
915572348 1:156751446-156751468 CCCCGGGCTCCGCGCCGGGCCGG + Intronic
915601242 1:156924363-156924385 TCCAGGGCCCCACGCCGGGCCGG - Intronic
919936678 1:202255485-202255507 CCCAGCGCCCTTCCCCGCTCAGG + Intronic
921836008 1:219779505-219779527 ACCAGGCCCCCTCTCCTGTCTGG - Intronic
922705752 1:227789223-227789245 ACCAGGGCTCCTTCCCGGTCAGG - Intergenic
1062961411 10:1576024-1576046 CCCAGGGCCACTCGGCGGGGGGG + Intronic
1063367782 10:5501469-5501491 CCCTGGGCCCCTCACCAGGCAGG - Intergenic
1065354387 10:24825423-24825445 ACCAGGGCCTGTCGCCGGTTGGG - Intergenic
1067806810 10:49398209-49398231 GCCGGGGCCCCTCGCTGCTCAGG + Intergenic
1069424723 10:68279148-68279170 CCCATGGCCCCGCGGCGGTCCGG - Intergenic
1069724164 10:70566760-70566782 CACAGGGCCCCACGCAGGCCTGG + Exonic
1070796982 10:79222620-79222642 CCCTGGGCCCCTGGCCAGCCTGG + Intronic
1073137308 10:101227184-101227206 CCCAGCTCCCCTCGGCGGTCCGG + Exonic
1074882043 10:117667134-117667156 CCCAGGGCACCACCTCGGTCTGG - Intergenic
1076371578 10:129959234-129959256 CCGAAGGCCCCTCGCAGGCCTGG - Intronic
1076707571 10:132310029-132310051 CCCAGGACGCCTCCCCGGCCCGG + Intronic
1077114999 11:880144-880166 CCCAGGGCCCCTGGCTCGTTTGG - Intronic
1077431992 11:2520338-2520360 CCGAGGGCCCCACGCTGGGCTGG - Intronic
1079334031 11:19555439-19555461 CCCAGAGCCCCCCCCAGGTCTGG - Intronic
1080836480 11:35944806-35944828 CCCAGGGCCCCTCGCCGGTCAGG - Intronic
1081969168 11:47186357-47186379 CCCTGGGCCCCTCGGCGGGTGGG + Intronic
1083431034 11:62613561-62613583 CCCAGGACCCCTCGCCAGGGAGG - Exonic
1085197899 11:74683393-74683415 CTCAGGGGCCCTCCCCGGGCTGG + Intergenic
1088995286 11:114990445-114990467 CCCAGGGCCACTCACAGGCCAGG + Intergenic
1090763328 11:129855905-129855927 ACCCAGGCCCCTCGCTGGTCTGG + Intronic
1092171502 12:6376270-6376292 ACCTGGGCCCCTCCCGGGTCTGG - Intronic
1092387589 12:8048035-8048057 CCCAGGGCCCCTCAGCTGTAGGG + Exonic
1094479983 12:30874091-30874113 CCCAGGGCCCCTCATCAGTTTGG + Intergenic
1094848023 12:34369934-34369956 CCCTGGGCCCCACGCAGGTGCGG + Intergenic
1094850584 12:34380619-34380641 CCCTGGGCCCCTCGCATGTGCGG + Intergenic
1097245450 12:57605197-57605219 CCCAGGGACCCTTGCCCATCCGG + Intronic
1097246603 12:57610901-57610923 CCCCTGGCCCCTCGCCAGCCCGG + Intronic
1097834299 12:64257859-64257881 CCCAGGGCCTCTCCCCGGGAAGG + Intergenic
1097872092 12:64610393-64610415 CCCTGGGCCCCGCCCCGGACGGG - Intergenic
1097990331 12:65825855-65825877 CCCGGGGCTGCTCGCGGGTCGGG + Intronic
1100403384 12:94251566-94251588 CCTGGGGCCTCTCGCCGGGCAGG + Intronic
1102258770 12:111430865-111430887 CCCAGGGTCCCTCCCCGGGATGG + Intronic
1102677553 12:114668834-114668856 CCCAGGGCCCGTCTCAGCTCAGG + Intergenic
1110860514 13:80341036-80341058 CCCAGGCCCCCGCGCCCGCCCGG - Intergenic
1112529180 13:100183766-100183788 CCCAGGGCCCCTCGCCTTCCGGG - Intronic
1113682767 13:112255816-112255838 TCCAGGGCCCCTCGGCGTTTTGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114553299 14:23546654-23546676 CCCAGAGCCCCTTGCCTCTCTGG - Intronic
1118265804 14:64294193-64294215 CCCAGAGCCCGTCGCAGCTCGGG + Exonic
1119176738 14:72574108-72574130 CACAATGCCCCTCCCCGGTCAGG + Intergenic
1121001531 14:90454844-90454866 CCCGGGGACCCTGGCCGGCCAGG + Intergenic
1122230989 14:100306275-100306297 CCTGAGGCCCCTCGCCGGGCTGG + Exonic
1122978490 14:105180925-105180947 CCCGCGGCCCCTCCCCGGCCTGG + Intronic
1123116189 14:105895145-105895167 CCCATGGTCCCTCGCCTGCCTGG - Intergenic
1123473187 15:20569592-20569614 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1123644819 15:22430761-22430783 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1123666120 15:22610554-22610576 CCCTGGGCTCCTCTCAGGTCTGG - Intergenic
1123733488 15:23164603-23164625 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1123751618 15:23361978-23362000 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1124283991 15:28385903-28385925 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1124298706 15:28525711-28525733 CCCTGGGCTCCTCCCAGGTCTGG - Intronic
1124319943 15:28704960-28704982 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124340102 15:28885285-28885307 CCCAGGGCCCCGCGGAGGTCAGG + Intronic
1124521010 15:30406746-30406768 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124537652 15:30559474-30559496 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1124544108 15:30611529-30611551 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1124564072 15:30798964-30798986 CCCTGGGCTCCTCTCAGGTCTGG + Intergenic
1124754507 15:32395764-32395786 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124761004 15:32448113-32448135 CCCTGGGCTCCTCTCAGGTCTGG - Intronic
1124777630 15:32600950-32600972 CCCTGGGCTCCTCTCAGGTCTGG + Intronic
1124983575 15:34584411-34584433 CCCAGGGCCCCGCGGAGGTCAGG - Intronic
1125717664 15:41828221-41828243 CCCAGGGCCCCTCCCGTGTTCGG - Intronic
1125796681 15:42408844-42408866 TCCAGGGCCCCTCTTCTGTCTGG + Intronic
1129029913 15:72610540-72610562 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1129038129 15:72663288-72663310 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129211761 15:74073943-74073965 CCCTGGGCTCCTCCCAGGTCTGG - Intronic
1129398642 15:75267141-75267163 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129402250 15:75291417-75291439 CCCTGGGCTCCTCCCAGGTCTGG + Intronic
1129716836 15:77857224-77857246 CCCAGGGGCCCTTGCAGGCCTGG + Intergenic
1129851998 15:78798729-78798751 CCCAGGGCCCCTCCCCTCCCTGG - Intronic
1130259431 15:82344051-82344073 CCCTGGGGCCCTCCCAGGTCTGG - Intronic
1130484811 15:84392798-84392820 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1131200127 15:90388650-90388672 CCCAGCGCCTCTCGCCGCCCAGG + Intronic
1131282664 15:91033816-91033838 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1132688300 16:1171348-1171370 CCCAGGGCCACTGGCCCATCTGG - Intronic
1132713248 16:1278526-1278548 CCCCCGGCCCCTCGCCTGTCAGG + Intergenic
1132790453 16:1683557-1683579 CCCAGGGCCCCTGTCCACTCAGG - Intronic
1133021884 16:2970365-2970387 CTCAGGGCCCCTTGCCCGCCTGG - Intronic
1133229385 16:4359470-4359492 CCCAGCCCACCTTGCCGGTCAGG + Exonic
1133275218 16:4634214-4634236 CCCTGGGCCCCTTTCAGGTCTGG + Intronic
1137267932 16:46884211-46884233 CACAGCGCCCCGCGCCGGGCCGG - Intergenic
1137565140 16:49528073-49528095 CCCAGAGCCCCTAGCTGGGCAGG - Intronic
1141477166 16:84281734-84281756 CCCAGGTCCCCTCGCCTACCAGG + Intergenic
1141564315 16:84891247-84891269 CCCTGGGCCCCTGGACGCTCAGG + Intronic
1141685068 16:85565530-85565552 CCATGGGCCCCTCGCCGGTGTGG - Intergenic
1141949792 16:87333131-87333153 CCACGGGCCCCTTGCCGTTCAGG - Intronic
1141989493 16:87602274-87602296 CCCCGGGGCCCCCGCCGGACTGG - Intronic
1142175617 16:88643641-88643663 CCCAGGGCCCCTAGCGGGGTGGG - Intronic
1142285792 16:89171079-89171101 CCTTGGGCCCCTCGCCTCTCTGG - Intergenic
1142302484 16:89266664-89266686 CTCAGGGACCCTCCCAGGTCGGG + Intergenic
1142494124 17:297225-297247 CCCAGGGCACCTCTCCCATCTGG + Intronic
1143021552 17:3919409-3919431 CCCAGGGCCCTGCTCCAGTCAGG - Intergenic
1143590841 17:7885213-7885235 CCCGTGGCCCCGCGGCGGTCCGG + Intronic
1144185073 17:12789516-12789538 CCCGGGTCCCCGCGCCGGACTGG + Intergenic
1144252242 17:13429309-13429331 ACCAGGGCCTCTCGCCTGCCTGG + Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146912563 17:36658047-36658069 CCCAAGGCCCCGGGCCGGTGCGG + Intergenic
1147994504 17:44353612-44353634 CCCTGGGCCCCTCTCCGGCCTGG + Exonic
1147995648 17:44358948-44358970 GCCAGGTCCCCTCGCAGGTTAGG + Intronic
1148357269 17:46983863-46983885 CCAATGGCCCCTCCCTGGTCAGG - Intronic
1148452665 17:47790121-47790143 CCCGGGGACCCACGCCGCTCTGG + Intergenic
1148615476 17:48997284-48997306 CACAGGGCCCCTCGGCCCTCCGG - Intergenic
1149637268 17:58180958-58180980 GCCAGGGCTCCTCACCAGTCTGG + Intergenic
1151465449 17:74282013-74282035 CCCAAGGGCCCTGGCCTGTCAGG + Intronic
1151662461 17:75525902-75525924 CCCAGGACCCCTGGGCTGTCGGG + Intronic
1152227172 17:79097852-79097874 CCCAGGGCGCCTCCCCGCGCCGG + Intronic
1152282285 17:79391993-79392015 GCCAGGGCCCCGCGATGGTCAGG + Intronic
1152352952 17:79793479-79793501 CCCAGGGCCTCTCCACGGCCAGG - Exonic
1158385138 18:56980870-56980892 ACCAGAGGCCCTCGCCAGTCAGG + Intronic
1158546119 18:58398874-58398896 CCCAGGGCTACTCCCCGGGCAGG - Intronic
1158930973 18:62325125-62325147 CCCGGGGCCCCTCCCCGAGCGGG + Intergenic
1160499731 18:79395794-79395816 CCCGGGGCCCCGCGCGGGCCCGG + Intergenic
1160704990 19:525448-525470 CCCTGGGCCTCTAGCCAGTCGGG + Intergenic
1160730779 19:640797-640819 CCCAGTGCCCCCCGCCCGGCGGG - Intronic
1161217604 19:3102256-3102278 CTAACTGCCCCTCGCCGGTCAGG - Intronic
1161285740 19:3467434-3467456 CCCAGGGCCCCACCCTGGGCTGG + Intronic
1161595618 19:5149739-5149761 CCCAGTGCCCCTCACCAGTCAGG + Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1162470958 19:10871759-10871781 CGCAGGGCCCCGCGCCGCCCGGG - Exonic
1162771756 19:12953503-12953525 CCAAGGCCCCCTCCCCAGTCTGG + Exonic
1163714767 19:18867372-18867394 CGCAGGGCCCCGCACCGGTGAGG + Exonic
1165921525 19:39301240-39301262 CCCAGGCTCCCTCGCAGCTCAGG + Intergenic
1166361179 19:42253674-42253696 CCCAGGGCCCCTCCTCGGTCCGG + Intronic
1166855852 19:45782367-45782389 ACCATGGCCCCTCCCCGGGCCGG + Intronic
1168652091 19:58097935-58097957 TGCAGGGCCCCTCACCGATCTGG + Intronic
925337395 2:3108284-3108306 CTCCGGGCCCCTCCTCGGTCTGG - Intergenic
927685515 2:25168212-25168234 CCCAGGGGCTCGCGGCGGTCCGG - Intronic
929555996 2:42925990-42926012 CCCAGCACCCCTCACCGCTCAGG - Intergenic
929600441 2:43201150-43201172 CCCAAGACCCCTGGCAGGTCTGG + Intergenic
934035630 2:88086550-88086572 CCCAGAGCCCCGCTCCGGCCAGG + Intronic
936513696 2:113168399-113168421 CCCAGGGCCCCTCTCCTGGAAGG + Intronic
937132572 2:119524361-119524383 CCCGGGGCCCGCCGCAGGTCGGG - Exonic
937323226 2:120973357-120973379 CCCATGGCCACACGCCGGTAGGG + Intronic
943301890 2:186213097-186213119 CCCAGGGCCCCTGGCAAGTAGGG + Intergenic
944221888 2:197311010-197311032 CCCAGGGCCCGGGGCCGGCCCGG - Intronic
946180798 2:217947777-217947799 CCCAGGGCCCCTCAGTGGCCGGG + Intronic
947552595 2:231057164-231057186 CCCAGGGCCCACCCCCGGGCCGG + Intronic
947593528 2:231397622-231397644 CCCAGGTCCACTTGCCCGTCTGG + Intronic
947605457 2:231482996-231483018 CCCAGAGCCCCTCGCCTCCCTGG + Intronic
948884772 2:240877156-240877178 CCCAGGCCCCCTCTCCTCTCAGG - Intronic
1172320938 20:33994471-33994493 CCCTCCGCCCCTCGCCGGGCGGG - Intronic
1173162774 20:40664505-40664527 CCCAGGGCCCCTTGCTGGGCTGG - Intergenic
1174363809 20:50044262-50044284 CCTACGGCCCCTCCCCGCTCAGG + Intergenic
1175399704 20:58693229-58693251 CCCAGGCCCCGTCGCCGGTGCGG + Intronic
1176382031 21:6118430-6118452 CCCAGGCTCCCTCCCCTGTCAGG + Intronic
1178619090 21:34158609-34158631 CCCAGGGCCCCTCCACCCTCTGG - Intergenic
1179741441 21:43419809-43419831 CCCAGGCTCCCTCCCCTGTCAGG - Intronic
1180177787 21:46098614-46098636 CGCAGGGCCTCTCCCCGGGCCGG + Intronic
1183479759 22:38057114-38057136 CTCAGGGGCCCGCGCCGGCCCGG - Intronic
1185237907 22:49725324-49725346 CCCTGGGCCCCACACCGGCCAGG + Intergenic
1185259515 22:49853815-49853837 CCCAGGGCCCCGCGCGGCGCGGG - Intergenic
1185373026 22:50469628-50469650 CCCAGGGCCCATCCTCTGTCTGG + Intronic
1185409175 22:50673731-50673753 CCAAGGACCCCTGGCCGGTCCGG - Intergenic
950815744 3:15700290-15700312 CCCAGGCCCCCACCCCGGACAGG - Intronic
952316850 3:32238922-32238944 CCCAGGGACCCCGGCGGGTCTGG - Exonic
962476443 3:135759212-135759234 CACAGGGCTCCTCACAGGTCAGG + Intergenic
962707882 3:138062634-138062656 AGCAGGGCCCCTCACAGGTCAGG + Exonic
963066580 3:141269099-141269121 CCCAAAGCCCCTCGCCTGTCTGG + Intronic
965701160 3:171460312-171460334 CCCAGCGCCCTTAGCCGATCGGG - Exonic
967420819 3:189270517-189270539 CCCAGGTCCCCACGCCAGTGAGG + Intronic
968571130 4:1341286-1341308 CCCAGTGCCACTCGCTGGTGTGG - Intergenic
968663819 4:1810135-1810157 CCCAAGGCCCCTCTCCTGTCAGG + Intergenic
969058530 4:4416754-4416776 CCCAAGGCCCCTCTCTGCTCTGG + Intronic
969526003 4:7704405-7704427 CCCAGGTCCCCTTGCTGGTGAGG + Intronic
979205627 4:118033830-118033852 CCCAGGGCCCCTCGTCCGGGTGG - Intronic
981748089 4:148069796-148069818 CCCTGGGCCCCTTGCCACTCAGG + Intronic
985685143 5:1277962-1277984 CCCAAGGCCCCCGGCCGCTCTGG + Intronic
986151143 5:5131393-5131415 CTCAGGCCCCCTCTCCTGTCTGG + Intergenic
987108776 5:14665160-14665182 CCCAGGGCCCCTCACAATTCTGG + Intronic
997255934 5:132427973-132427995 CCCAGGGCTCCTGGCTGGCCTGG - Intronic
997521379 5:134526332-134526354 CCCGCGCCCCCTCGCCGGCCCGG - Intronic
997885776 5:137628522-137628544 CCCAAGTCCCCTCACTGGTCAGG - Intronic
999262032 5:150244397-150244419 CCCTGGGGCCCTCGCCAGGCAGG + Intronic
1002455870 5:179345144-179345166 CCCCGGGACCCCCGCCGGCCTGG - Intronic
1002524461 5:179807347-179807369 CCCAGGGCGCTTCCCCGCTCAGG + Intronic
1003964699 6:11241830-11241852 CCCAGAGCCTCTGGCCTGTCCGG + Intronic
1005328007 6:24720799-24720821 CCTCGGGCGCCTCGCGGGTCCGG + Exonic
1007363265 6:41373343-41373365 CCCAGCGCCCCCCACCGGGCCGG + Intergenic
1007610098 6:43143613-43143635 TCCAGGGCCCCTCACCGTTGAGG - Exonic
1015220674 6:130801590-130801612 CCCGTGGCCCCGCGGCGGTCCGG - Intergenic
1015634811 6:135264707-135264729 CGCAGGGGTCCTCGCCTGTCTGG + Intergenic
1018857636 6:167685904-167685926 CCCAGTGCACCTCACCGGCCTGG + Intergenic
1019088099 6:169500869-169500891 CCCAGGGCCCCGTGCAGGGCAGG + Intronic
1019524743 7:1475891-1475913 CCCAGGTGCCCTGGCCGGGCAGG - Intronic
1020032798 7:4944596-4944618 CCCATGGCCACTGGCCGGGCTGG - Intronic
1023862929 7:44226565-44226587 CCGAGGGCCCCTCGCCAGTGGGG - Exonic
1024520862 7:50303785-50303807 CCCGGGGCCGCTGGTCGGTCGGG - Intergenic
1027227125 7:76250915-76250937 CCCAGGGCCCCTGGCAGGCCTGG + Intronic
1029403255 7:100358237-100358259 CACAGGGCCCCTCTCCTGCCTGG + Exonic
1029405828 7:100373591-100373613 CACAGGGCCCCTCTCCTGCCTGG + Exonic
1029440266 7:100583436-100583458 CCCTGGGCCCCTCCCAGGACAGG - Intronic
1033214408 7:139483309-139483331 CCCCGGGCGCCTCGCCATTCCGG + Exonic
1034414514 7:150957536-150957558 CCCAGGGCCCCAGGCCAGGCAGG + Intronic
1035201913 7:157273103-157273125 CCCAGGGCCCCAAGCCGGGGAGG - Intergenic
1035385782 7:158471846-158471868 CCCAGGGCCCCTCTCAGGCTGGG + Intronic
1035612151 8:973811-973833 CCCGTGGCCCCGCGGCGGTCCGG + Intergenic
1036643657 8:10599273-10599295 CCCATGGCCCCTGGCTGCTCTGG - Intergenic
1037579257 8:20235018-20235040 CCCCGGGACCCTCCCCCGTCTGG + Intergenic
1038455814 8:27671247-27671269 CCCATGGCCCCCCGCTGGCCTGG - Exonic
1039568137 8:38565477-38565499 CCCAGGGCCTCTCTCCACTCCGG + Intergenic
1040038723 8:42896329-42896351 CCCCGGGCCCCTCCCTCGTCTGG - Exonic
1049126666 8:140795323-140795345 CCCAGGGCCAGTGGCTGGTCAGG - Intronic
1049343926 8:142128521-142128543 CCCAGGGGCCCTCACTGCTCAGG - Intergenic
1049509207 8:143019155-143019177 CGCCGGGCCCCTCCCCGTTCCGG + Intronic
1049675704 8:143887978-143888000 TCCTGGGCCCCTCGCAGGGCTGG + Intergenic
1050461893 9:5884459-5884481 CTCAGGGCCCCAGACCGGTCTGG - Intronic
1057207799 9:93184093-93184115 CCCAGCCCCCTGCGCCGGTCCGG + Intergenic
1061778735 9:132983615-132983637 CCCAGGGCTCCTGGCCTGTTAGG - Intronic
1062237151 9:135515743-135515765 CCCAGGGTCCCTCGCCCTTCCGG - Intergenic
1062606877 9:137352398-137352420 CCCAGGGTCCCTCATGGGTCGGG + Intronic
1190303094 X:49067632-49067654 CCCAGGACCCCTCTCCCGCCGGG + Exonic
1199606899 X:149585332-149585354 TCCAGGGGGCCTCGTCGGTCTGG + Intronic
1199632224 X:149784036-149784058 TCCAGGGGGCCTCGTCGGTCTGG - Intronic
1200224821 X:154411675-154411697 CCGAGGTCCCTTCGCAGGTCAGG - Exonic
1200238848 X:154483181-154483203 CTCAGGGCCCTTCACCGGGCAGG + Intergenic
1202367141 Y:24173184-24173206 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1202373287 Y:24212489-24212511 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic
1202497495 Y:25457631-25457653 CCCTGGGCTCCTCCCAGGTCTGG + Intergenic
1202503640 Y:25496939-25496961 CCCTGGGCTCCTCCCAGGTCTGG - Intergenic