ID: 1080841228

View in Genome Browser
Species Human (GRCh38)
Location 11:35985263-35985285
Sequence CCACAGAACCAGACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080841228_1080841231 2 Left 1080841228 11:35985263-35985285 CCTTCCACTGTCTGGTTCTGTGG 0: 1
1: 0
2: 5
3: 32
4: 314
Right 1080841231 11:35985288-35985310 TCCCTATTGCATGTCTCTCTTGG 0: 1
1: 0
2: 4
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080841228 Original CRISPR CCACAGAACCAGACAGTGGA AGG (reversed) Intronic
902518878 1:17004786-17004808 CCACAGTCCCAGGCAGAGGATGG - Exonic
902819321 1:18933957-18933979 CCACAGAGACAGAAAGTAGAAGG - Intronic
903417550 1:23194191-23194213 CCACTGAACCAGTCAGCAGAAGG - Exonic
903774271 1:25782769-25782791 CCACAGAACCTGACTGTGGAGGG - Intronic
905866462 1:41379608-41379630 CCAGAGAACCAGGCAGGGCAAGG + Intronic
907542878 1:55232693-55232715 CCACAGAGACAGACAGCAGAGGG - Intergenic
910924964 1:92388715-92388737 CCACTGAACCAGGCATGGGAGGG - Exonic
911218012 1:95216648-95216670 CCACTGAGCCAGGCACTGGAGGG + Intronic
913196115 1:116457576-116457598 TCACAGAATCACACAGTGGCGGG + Intergenic
922465408 1:225843018-225843040 ACACAGGACCAGACAGTGCTGGG + Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924537131 1:244945308-244945330 TCATAGAAACAGAAAGTGGAAGG + Intergenic
924808951 1:247384334-247384356 CTACAGAACCAGTCAGGAGAAGG + Intergenic
1063260713 10:4386330-4386352 CCACTCAACCATAAAGTGGAGGG - Intergenic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1064711606 10:18132791-18132813 ACACAGAATAACACAGTGGAAGG + Intergenic
1065845220 10:29737406-29737428 TTACAGAATCAGACACTGGAGGG - Intergenic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1067341875 10:45412348-45412370 CCCCAGCACCAGCCACTGGAGGG - Intronic
1068123595 10:52810772-52810794 CCACGGAACTAAAAAGTGGATGG + Intergenic
1068968643 10:62939337-62939359 CCAAAAATCCAGACAGAGGATGG - Intergenic
1069289651 10:66762337-66762359 CCACAGAACCACAGTGGGGAAGG - Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069567823 10:69475173-69475195 CCACAGAAACAGCCATGGGAAGG - Intronic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1074693730 10:116029475-116029497 CCACAGCCCCAGAAGGTGGAGGG + Intergenic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1076717433 10:132373478-132373500 ACACAGAACCAGGCACTGGGAGG + Intronic
1077388811 11:2289737-2289759 CCATAGAGACAGAAAGTGGATGG + Intergenic
1077831922 11:5882161-5882183 CCACAGTAGCAGACAGTGTATGG - Intronic
1078145017 11:8716497-8716519 TTCCAGAACCAGACAGTGGTTGG - Intronic
1079422175 11:20303847-20303869 ACACAGCACCAGACGGTGCAAGG + Intergenic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1081461831 11:43279308-43279330 CCACACAACCAGATGGCGGAGGG - Intergenic
1081771522 11:45653040-45653062 CCACAGGACCAGACAGCAAAGGG - Intronic
1082920909 11:58492890-58492912 TCATAGAAACAGACAGTGAATGG + Intergenic
1084146963 11:67270115-67270137 CCACAGACCCTGAGAGTGAAGGG - Intronic
1084182010 11:67451515-67451537 CCACAGAATCTGACTGTGGCTGG + Exonic
1084568936 11:69948223-69948245 CCACAGAACCAGACTCTCCAGGG - Intergenic
1085448751 11:76618048-76618070 TCACACAGCCAGACAGTGGGAGG + Intergenic
1086859535 11:91908775-91908797 TCACAGAAACAGACAGCAGATGG - Intergenic
1087429086 11:98028548-98028570 CCACTTAACCAAACAGTAGATGG + Intergenic
1087459412 11:98425829-98425851 CCACAGAAACAGAGAGTATAAGG - Intergenic
1088007579 11:104961349-104961371 CCACAGAACCAGTCAGGAGAAGG - Intronic
1088391997 11:109324618-109324640 ACACTGTACCAGAAAGTGGATGG + Intergenic
1088456340 11:110036570-110036592 CCACAGAGACAGAGACTGGATGG - Intergenic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089658465 11:119969793-119969815 CCACTGCACCAGACACTGGATGG - Intergenic
1091060509 11:132457043-132457065 CCACAGAACCAGACTGCTGTGGG + Intronic
1092025665 12:5237702-5237724 ACAAAGACCCAGAGAGTGGAGGG - Intergenic
1092289227 12:7149228-7149250 CCAGAGAACCAGCCAGTGTCTGG + Intronic
1093900436 12:24625417-24625439 CCACAGAGCCAGGCATGGGAGGG + Intergenic
1094053406 12:26244704-26244726 CCACTGAACCACACTGTGGCAGG - Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1096183344 12:49563332-49563354 GCACATATCCAGACAGTGGGTGG + Intronic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1096700969 12:53382476-53382498 CCACAGTTCCAGACCGTTGATGG + Exonic
1099946817 12:89254499-89254521 GGACCGAACCAGAAAGTGGAAGG + Intergenic
1101430701 12:104624648-104624670 GCACAGAGCCTGACAGTGGCAGG + Intronic
1101632071 12:106504886-106504908 GCAGTGAACAAGACAGTGGATGG + Intronic
1102282165 12:111627006-111627028 TCACAGAACCAGGCAGTAGCAGG + Intergenic
1102642312 12:114377980-114378002 CCACCCAACCAGAGAGTGGATGG - Intronic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1102741455 12:115211128-115211150 CTACAGTCCCAGACAGGGGAGGG + Intergenic
1102907618 12:116688844-116688866 CCACAGAAGCAGGCGGTGGTGGG + Intergenic
1103871438 12:124095232-124095254 TCACAGACCCAGACATTGGTGGG + Intronic
1103980677 12:124735007-124735029 TCACAGAACCAGAAGATGGAAGG + Intergenic
1104269568 12:127270737-127270759 CCACTCAAGCAGATAGTGGAGGG - Intergenic
1104583724 12:130030420-130030442 CCACAGAACCAGGCAAGGCAGGG + Intergenic
1105243951 13:18631191-18631213 CCACTGAGCCAGACATGGGAGGG - Intergenic
1105977420 13:25484381-25484403 CCACAGAGCCAAAAAGTTGATGG - Intronic
1106326357 13:28694003-28694025 CCACACAGCCAGGCACTGGAAGG + Intergenic
1107479220 13:40771410-40771432 CCGGCGAACCCGACAGTGGAGGG + Intergenic
1107965456 13:45593738-45593760 CCACAGGAGCAGAGAGTGAAGGG - Intronic
1108622109 13:52194661-52194683 CCGCCGAACGAGATAGTGGAGGG + Intergenic
1108664595 13:52617254-52617276 CCGCCGAACAAGATAGTGGAGGG - Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1109996475 13:70133867-70133889 ACACAGTACCAGAAAGTGGGTGG - Intergenic
1111219777 13:85189168-85189190 ACAGACTACCAGACAGTGGAGGG + Intergenic
1112698395 13:101975944-101975966 CCACAGAACCAGGCCGTGGTTGG - Intronic
1113269512 13:108657198-108657220 CCAAAGAGCTAGACAATGGAGGG - Intronic
1113457324 13:110457992-110458014 CCACAGAGCCTCACAGAGGACGG - Intronic
1113510546 13:110850963-110850985 CCACAGACCCCGAAAATGGAGGG + Intergenic
1114190619 14:20437162-20437184 GATAAGAACCAGACAGTGGAAGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1118930378 14:70234892-70234914 CCGCTGAGCCAGGCAGTGGAGGG - Intergenic
1120032251 14:79655283-79655305 TCACAGAGCCAGAAAGTGGCAGG - Intronic
1120061515 14:79988891-79988913 CCACATAAATAGAGAGTGGAGGG + Intergenic
1121489578 14:94348305-94348327 CCACAGCAGAGGACAGTGGAAGG - Intergenic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122195685 14:100083337-100083359 ACACAGAACCAGACAGACGTTGG - Intronic
1123700844 15:22913856-22913878 CCACAGCCACAGAGAGTGGAAGG + Intronic
1126444640 15:48728290-48728312 CAAAAGAACTAGACAGTGGTGGG + Intronic
1127434083 15:58939223-58939245 CCAGAGAACAAGACAGAAGAGGG + Intronic
1127679530 15:61279747-61279769 AACCAGAACCACACAGTGGAAGG + Intergenic
1128368281 15:67020339-67020361 CCACAGCACCAGCCAGAGGGTGG - Intergenic
1129381367 15:75169590-75169612 CTACAGAACCAGTCAGGAGAAGG - Intergenic
1132615482 16:839441-839463 CCACAGACCCAGGCAGCAGAGGG - Intergenic
1132698651 16:1212966-1212988 CCACAGAACCACACACGGGTGGG - Intronic
1133119150 16:3595649-3595671 CCACAAACCCAGTCAGAGGAAGG + Exonic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1135511270 16:23085993-23086015 CCACCCAAACAGACACTGGACGG + Intronic
1137239776 16:46646135-46646157 CCACAGAAAAAGGCAGTGGGGGG + Intergenic
1139635137 16:68253983-68254005 CAACAGAACCAGACAGGGGCCGG - Intronic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1141438171 16:84012763-84012785 CCACAGACCCTCAGAGTGGAAGG + Intronic
1141697845 16:85628496-85628518 CCTCAGACCCAGGCATTGGAGGG + Intronic
1141880516 16:86855912-86855934 CCACAGCACCAGAGATTGGCAGG - Intergenic
1142198726 16:88751013-88751035 GCACAGAGCCAGACTATGGAGGG - Intronic
1142484880 17:240483-240505 GCACAGAGGCAGACAGTAGATGG - Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1145954005 17:28842308-28842330 CCTCTGAACCAGGCAGGGGAAGG - Intronic
1146203248 17:30879295-30879317 CCACAGCACTAGGCAGTGGTGGG + Intronic
1147497061 17:40926829-40926851 CAACAGAACCAGACAGTGTAGGG - Intronic
1148203047 17:45762728-45762750 CCCCAGCACCAGGCAGGGGAAGG + Intergenic
1148488083 17:48004061-48004083 GCACAGAACAAGACAGAGCACGG - Intergenic
1148889325 17:50796454-50796476 CCACATCATCTGACAGTGGAAGG + Intergenic
1150369534 17:64624804-64624826 CAACAGAGCAAGACAGGGGAGGG + Intronic
1151372901 17:73660240-73660262 CCACTGAAACAGGCAGTGGAGGG - Intergenic
1151428694 17:74048283-74048305 CCACAAAACCACAGAGAGGATGG + Intergenic
1152060243 17:78067806-78067828 CCTCAGTACCAGCCAGTGGGAGG + Exonic
1152780007 17:82222955-82222977 CCACAGACACAGACAGCAGATGG + Intergenic
1153369201 18:4294886-4294908 TCAGAGAATCAGCCAGTGGATGG - Intronic
1154444992 18:14428706-14428728 CCACTGAGCCAGACATGGGAGGG + Intergenic
1155320395 18:24613128-24613150 ACACAGAACGGGACACTGGATGG - Intergenic
1155875090 18:31076113-31076135 ACACAGCCCCAGGCAGTGGATGG - Intronic
1157177513 18:45465035-45465057 AGACAGAAACAGACAATGGAAGG + Intronic
1157880836 18:51319739-51319761 CCACAGATCCAATCAGGGGAGGG - Intergenic
1157947169 18:51993194-51993216 ACACACACACAGACAGTGGAGGG + Intergenic
1158769127 18:60493424-60493446 CCACTGAACCAGGAAGTGGGAGG - Intergenic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1160430170 18:78805524-78805546 CCCCTGAACCTGACAGTGGCAGG - Intergenic
1160618735 18:80154533-80154555 GCACAGAACCAGACCGCAGAAGG - Intronic
1162813506 19:13179253-13179275 CCACAGAGACAGAAAGTAGATGG - Intergenic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1166822944 19:45591747-45591769 CCACAGAGCCAGGCAGTTGGTGG + Exonic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925588957 2:5491250-5491272 CCAAAGGACCACACACTGGATGG - Intergenic
925906330 2:8541734-8541756 TCAGAGAACCAGGCAGTGGAAGG + Intergenic
927001047 2:18794365-18794387 CTACAATACCACACAGTGGAGGG - Intergenic
927205664 2:20608800-20608822 GCACTGAATCAGAAAGTGGAGGG - Intronic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
928115505 2:28542943-28542965 TCACTGAACTAAACAGTGGAAGG - Intronic
928198475 2:29231678-29231700 CCACACAATCAGACTGTGGGAGG - Intronic
928200019 2:29241868-29241890 CCACACAGCCAGTCAGTGGCTGG + Intronic
930249009 2:49014490-49014512 GCACAGCTCCAGACAGAGGAAGG - Intronic
931857359 2:66317370-66317392 CCACAAAACCAGGCAGTGGCAGG + Intergenic
932051586 2:68403669-68403691 CCACAGAGCCAGGCACTGGAGGG + Intergenic
932208887 2:69910306-69910328 CCCCAGCACCACACAGTGGCTGG + Intronic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934721775 2:96583194-96583216 CCACAGAATCAGACAGATAATGG - Intergenic
935008392 2:99105539-99105561 CCACAGAACGAGATAGTCTAAGG - Exonic
935304030 2:101719489-101719511 CAGCAGACCCAGACAGTGGCAGG + Intronic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
936242284 2:110798219-110798241 AAACAGAACCACACAGTGCAGGG - Intronic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
937617320 2:123941273-123941295 GAAGACAACCAGACAGTGGAAGG + Intergenic
939116085 2:138062418-138062440 CCACAGGAGCAGTAAGTGGAAGG + Intergenic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
940042787 2:149377836-149377858 ACACAGATACAGACACTGGAAGG - Intronic
940251781 2:151685677-151685699 CCAGAAAACCAGACAATGAAGGG - Intronic
941606446 2:167603265-167603287 CCACAGAATGATGCAGTGGAAGG + Intergenic
942240199 2:173955970-173955992 CCACAGATCCAGTCAGCAGATGG - Exonic
942328727 2:174798887-174798909 GCACAGAAACAGACTCTGGAGGG + Intergenic
943720802 2:191201599-191201621 GCACAGAACCATACAATGGAAGG - Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944948973 2:204725187-204725209 CCACTTAATCAGACAGTAGAGGG + Intronic
945016419 2:205522978-205523000 CCTCAGAACCAAACAGTATATGG - Intronic
945711005 2:213294111-213294133 CTACAGAAACAGACATTAGAAGG - Intronic
947582587 2:231330769-231330791 CCAAAGGACCTGACAGGGGAAGG - Intronic
947882606 2:233532063-233532085 CCAACGAATCAGACAGTGGGTGG + Intronic
947947868 2:234121932-234121954 CCTCAGGACCAAACACTGGAAGG - Intergenic
1169081740 20:2801394-2801416 GTAAAGAACCAGACCGTGGAAGG - Intergenic
1169523995 20:6403103-6403125 GCACAGAACCAGAGAGAGAAGGG - Intergenic
1169537732 20:6563934-6563956 TGACAGAACCACACACTGGAGGG - Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1172770467 20:37379380-37379402 CCCCAGAACCAGGAAGTGCAAGG + Intronic
1172871280 20:38136891-38136913 TGACAAAGCCAGACAGTGGAAGG + Intronic
1174098623 20:48109453-48109475 CGACACAACCACACAATGGAGGG - Intergenic
1174295827 20:49544349-49544371 CTACAGAAGCAGGCAGTGGCTGG - Exonic
1174367730 20:50066673-50066695 CCCCAGGACCATACAGTGGAGGG + Intergenic
1175980499 20:62736251-62736273 CCCCAGACCCAGACAGGGAAAGG - Intronic
1176077938 20:63257129-63257151 GAACAGCAACAGACAGTGGAGGG + Intronic
1176099867 20:63360059-63360081 CCACAAAACCAGGCGGCGGATGG + Intronic
1176375506 21:6085220-6085242 CCACAGCAGCAGACACTGGACGG + Intergenic
1176450994 21:6861163-6861185 CCACTGAGCCAGACATGGGAGGG - Intergenic
1176829162 21:13726214-13726236 CCACTGAGCCAGACATGGGAGGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1178935221 21:36856021-36856043 CCATAGAAACAGAAAGTAGATGG + Intronic
1179297303 21:40074894-40074916 TCAGAGAACCAGGCAGTGGAGGG + Intronic
1179679997 21:43012763-43012785 CCACAGAGCGAATCAGTGGAAGG + Intronic
1179747968 21:43453024-43453046 CCACAGCAGCAGACACTGGACGG - Intergenic
1181600900 22:23951407-23951429 ACACAGAAGCAGTCTGTGGAGGG + Intergenic
1181607613 22:23989919-23989941 ACACAGAAGCAGTCTGTGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183601889 22:38844528-38844550 TCACCGGACCAGACTGTGGATGG + Intergenic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1185152869 22:49176100-49176122 ACACATTACCAGACAGTGGAAGG + Intergenic
949968989 3:9386319-9386341 CCACAGAACCAGGAAGTTCAAGG + Exonic
950185156 3:10940216-10940238 CCGCAGAACCAGACAGCTCAGGG - Exonic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
953150667 3:40321366-40321388 CCACAAAACAAGGCAGGGGAGGG + Intergenic
953717636 3:45329644-45329666 ACAAAGAACCACACACTGGATGG - Intergenic
954413700 3:50382517-50382539 CCACAGGAACAGACAGCGAAGGG - Intronic
954430421 3:50467915-50467937 CCCCACAACCAGACAGGAGATGG - Intronic
954633678 3:52060017-52060039 CCTCAGAACCACACAGAGAAGGG + Intergenic
954824858 3:53363828-53363850 CCACAGAACTGGACTTTGGAAGG + Intergenic
955335097 3:58078851-58078873 CCACAGAACAAGCTAGTGGGTGG - Intronic
956721248 3:72119731-72119753 CCCGAGAACCAGAGAGTTGATGG - Intergenic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
961839975 3:129701456-129701478 CCCCATAACCAGCCAGTGGGTGG + Intronic
962856994 3:139355954-139355976 CAATAGAAACAGACAGGGGAGGG + Intronic
963202939 3:142602782-142602804 ACACAGAACCACTCAGGGGAAGG - Intronic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
966935613 3:184706786-184706808 CTACAGAACCAGTCAGGAGAAGG + Intergenic
971607878 4:28681971-28681993 CCACAAAACTAGAAAGTGGTAGG + Intergenic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
972990903 4:44821703-44821725 CCACAGAAACAGTCACTTGATGG - Intergenic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
978184802 4:105844468-105844490 TCACAGAAAAAAACAGTGGAAGG - Intronic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979951520 4:126898903-126898925 ACACAGAACCAGACAGGGATGGG + Intergenic
980477320 4:133334294-133334316 CCACCGAGCCAGGCACTGGAGGG + Intergenic
980729121 4:136804574-136804596 CCACAGACTCAGTCAGTAGAAGG + Intergenic
981850965 4:149229724-149229746 CCACTGAACCAGGCACGGGAGGG - Intergenic
982126768 4:152190533-152190555 TCACAAAACCAGTCAGTGGTGGG + Intergenic
984041771 4:174744074-174744096 CCACAGCACCATACAGAGTAGGG - Intronic
986202757 5:5592812-5592834 CCACATAACCAGGCAGCGGAAGG - Intergenic
990975448 5:61556663-61556685 CCACAGATTCAGACAAAGGAGGG - Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996420733 5:123259080-123259102 CCACCGAGCCAGGCAGCGGAGGG + Intergenic
999454003 5:151699627-151699649 AGACAGAGTCAGACAGTGGAAGG + Intergenic
1000722657 5:164727699-164727721 CCACAGAACCAGACATGGAAAGG + Intergenic
1001260802 5:170226945-170226967 CCACAGAATCAGAAAGCAGATGG + Intergenic
1001288884 5:170442559-170442581 CCCCAGAGCCAGACAGGGCAGGG - Intronic
1002321089 5:178376454-178376476 CCCCAGCACCAGGCAGTGGGGGG - Intronic
1003419188 6:5940451-5940473 GCACAGAACCAGTCAGGAGAGGG - Intergenic
1003577708 6:7313053-7313075 CCTCGGAACAAGACAGTGGCAGG + Exonic
1004054497 6:12121888-12121910 GCACAGAACAAGACTCTGGAAGG + Exonic
1006376828 6:33676373-33676395 CCACAGACCCAGAGCGAGGATGG + Intronic
1006987714 6:38187613-38187635 CGACAGAAGCACACAGTGGGGGG + Intronic
1008544409 6:52573225-52573247 GCACAGAACAGGACACTGGAAGG + Intronic
1008698403 6:54068884-54068906 TCACAGACATAGACAGTGGAGGG - Intronic
1010943079 6:81942206-81942228 CCAGAGTATCAGACAGAGGAAGG - Intergenic
1011805126 6:91062771-91062793 ACACAGCACCAAACAGTGAAGGG - Intergenic
1012230402 6:96754337-96754359 CCACAGGACCAGACTATGGTTGG - Intergenic
1013828481 6:114243894-114243916 CCAAAGAATCAGGCAGTAGAAGG - Intronic
1016334871 6:142994066-142994088 CCACTGAACCAGTCATAGGAGGG - Intergenic
1017549406 6:155489130-155489152 CCACAAAAAGAGACAGTGAAGGG - Intergenic
1017885872 6:158599064-158599086 CCACAGAAACAGACCGCGGGAGG - Intronic
1018088973 6:160329362-160329384 GCACAGAGCCAGACAGGAGAAGG + Intergenic
1019322090 7:420405-420427 TCATAGACCCAGACAGTGGTGGG - Intergenic
1019790573 7:3010001-3010023 CAACAAAACCAAACAGTAGATGG + Intronic
1020203930 7:6101203-6101225 CCACAGCAGCAGACAAGGGATGG + Intergenic
1021071638 7:16248909-16248931 CCACTGAGCCAAACATTGGAGGG - Intronic
1021510785 7:21429670-21429692 CCACAACTTCAGACAGTGGAAGG + Exonic
1021784627 7:24139585-24139607 CAACAGTACCAGGCAGTTGAGGG + Intergenic
1021898462 7:25259583-25259605 CCACTGAATAATACAGTGGAGGG + Intergenic
1022241636 7:28518039-28518061 CCTCAGCACCAGACAATGAAGGG - Intronic
1022651280 7:32277924-32277946 CCAGAGAATCAGGCAGTGGGAGG + Intronic
1023652555 7:42387277-42387299 CAACAGAGCCAGAGACTGGAGGG - Intergenic
1023800154 7:43826925-43826947 CTACAGAACCAGTCAGGAGAAGG - Intergenic
1025257504 7:57394868-57394890 TCACAGAAGCAGACAGTAGAAGG - Intergenic
1029437742 7:100572468-100572490 CCGCTGAGCCAGGCAGTGGAGGG + Exonic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033995044 7:147335044-147335066 CTACAGAACCAGTAAGTGGCAGG + Intronic
1034329354 7:150269372-150269394 CCCCAGCACCAGACAGCGGGGGG - Intronic
1034668700 7:152840488-152840510 CCCCAGCACCAGACAGCGGGGGG + Intronic
1034732530 7:153400462-153400484 CCACAGACCCATACTGGGGAAGG - Intergenic
1035323043 7:158046483-158046505 GCACAGAACAAGACAGTGTCAGG - Intronic
1037780498 8:21865192-21865214 CAACAGAAACAGACAGGGGTTGG + Intergenic
1038039870 8:23715447-23715469 CCACATATACAGCCAGTGGAGGG - Intergenic
1038262479 8:26008473-26008495 CCACAGAGACACACAGTGGTTGG + Intronic
1038267668 8:26048731-26048753 GCACAGAGCCAGACAGTAGCCGG + Intergenic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1038971538 8:32642009-32642031 CCACAGATCCTATCAGTGGAGGG - Intronic
1039029732 8:33296452-33296474 CCATAGATCCAGACAAAGGAGGG - Intergenic
1040013672 8:42682943-42682965 TCACAGAAACAGAAAGTAGAAGG + Intergenic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041758677 8:61340373-61340395 TCACAGAAGTAGACAGTAGAAGG - Intronic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1045452218 8:102338743-102338765 TCACACAACTAGACAGTGGTAGG + Intronic
1045933632 8:107654946-107654968 CCACAAAACAAGGCAGGGGAGGG - Intergenic
1046631145 8:116624096-116624118 CCACAAATCCAGACAACGGATGG + Intergenic
1046980809 8:120334770-120334792 CCACAGTGCCAGACAGTAAAGGG + Intronic
1047338789 8:123960173-123960195 TCAAAGAACGAGAAAGTGGAAGG + Intronic
1049052205 8:140207516-140207538 GAAAAAAACCAGACAGTGGAAGG - Intronic
1049159904 8:141090270-141090292 CCACAGACGCAGGCAGTGGTTGG + Intergenic
1049534171 8:143170416-143170438 CCACAGACCTAGGCACTGGAAGG - Intergenic
1049979410 9:890593-890615 CCACACACTCAGCCAGTGGATGG + Intronic
1050309601 9:4339770-4339792 CCAGAGAACCAGAAACTGTAGGG + Intronic
1050924031 9:11241075-11241097 CCACAGCACCAGTGATTGGAGGG - Intergenic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1052276013 9:26677522-26677544 CCACAGGACCAGAAAGTCCAGGG - Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053944795 9:43295993-43296015 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1055778948 9:79798214-79798236 CCACAGAACTAGTAAGTGGCAGG - Intergenic
1055906222 9:81296076-81296098 CATCAGAACCAGACAGTGTAGGG + Intergenic
1056479681 9:86988472-86988494 CCACAGAACAAGGCAGAGGCTGG - Intergenic
1056506648 9:87264147-87264169 CCAAAGTGCCAGACACTGGATGG - Intergenic
1056773049 9:89493293-89493315 GCACAGAACCACCCAGTGGGTGG - Intronic
1058547967 9:106081323-106081345 AGACAGAACTGGACAGTGGAAGG + Intergenic
1058642432 9:107100524-107100546 CCACAGGAGCAGCCAGTGGAAGG - Intergenic
1058752993 9:108057703-108057725 TGACAAAAACAGACAGTGGATGG + Intergenic
1059243481 9:112828945-112828967 CCACAGAGACAGACAGTAGATGG - Intronic
1060306932 9:122421978-122422000 CCACAGAACCAGTCAGGAGAAGG + Intergenic
1060749106 9:126157204-126157226 CCACAGAGACAGAAAGTGGGAGG - Intergenic
1061653515 9:132069831-132069853 CCACATAGCAGGACAGTGGAAGG + Intronic
1061729666 9:132604051-132604073 CCACAGCACCTGACCGTAGAAGG + Intronic
1061904215 9:133688361-133688383 TCATAGCACCCGACAGTGGATGG - Intronic
1062536079 9:137021690-137021712 CCCCAGAGCCAGCCAGTGGGTGG - Intronic
1062624346 9:137436137-137436159 CCCCAGAACCTCACAGTTGAAGG - Exonic
1203518187 Un_GL000213v1:23354-23376 CCACTGAGCCAGACATGGGAGGG + Intergenic
1203587930 Un_KI270747v1:24571-24593 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1185721862 X:2388674-2388696 ACACAGACACAGACAGAGGAAGG + Intronic
1186261488 X:7784732-7784754 CCATAGAGACAGAAAGTGGATGG + Intergenic
1187189343 X:17018492-17018514 TCATAGAACCAGAAAGTAGATGG - Intronic
1187601620 X:20838535-20838557 GCACAGCACCAGACATTGGCTGG - Intergenic
1188071173 X:25720113-25720135 CCACAGCACCAGGCCGTGGTAGG - Intergenic
1189291107 X:39886763-39886785 CCACAGAACCAGGCAGTGGGTGG - Intergenic
1190341794 X:49303012-49303034 CCACAGCAGCAGAAAGTGCAGGG - Intergenic
1190528955 X:51355676-51355698 CCTCAGAACCAGGAAGTAGATGG + Intergenic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190855418 X:54289617-54289639 CCACAAAGCCAGACTGTGCAAGG - Intronic
1192093936 X:68190199-68190221 CCACATAACTAGACATTGAAAGG + Intronic
1192211525 X:69130876-69130898 CCACAGAACTAGTCACTGGTGGG - Intergenic
1192341973 X:70270216-70270238 CAACAAAACCAGAAAGTGGCAGG + Intronic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195898974 X:109777859-109777881 CCAGAGATCCAGACAGAGCATGG + Intergenic
1196225847 X:113165727-113165749 CCACATTACCAGACAGTAGTAGG - Intergenic
1196706810 X:118724173-118724195 CTGCAGGACTAGACAGTGGATGG + Intergenic
1197871082 X:131063450-131063472 CCACAGAAGCATACAGGGGTAGG + Intronic
1197882231 X:131178851-131178873 CCACAGAAGCAGGCAGGGTAAGG - Intergenic
1198711100 X:139505237-139505259 CCAAAGAACCAGCCTGTGCAGGG - Intergenic
1199006275 X:142700808-142700830 CCACATAACTAGAAAGTGGTAGG - Intergenic
1200179535 X:154141798-154141820 CCATAGAGACAGACAGTGGAAGG - Intergenic
1200760286 Y:7031883-7031905 CCAAAGACACAGACAGTGGAAGG + Intronic
1201749135 Y:17413353-17413375 CTACAGAACCAGTCAGGAGAAGG - Intergenic
1201755010 Y:17477806-17477828 ACACAGTACCACACAGTTGATGG - Intergenic
1201846542 Y:18428179-18428201 ACACAGTACCACACAGTTGATGG + Intergenic