ID: 1080841453

View in Genome Browser
Species Human (GRCh38)
Location 11:35987215-35987237
Sequence CTGAAGTCTGCATATTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080841453 Original CRISPR CTGAAGTCTGCATATTTTTA GGG Intronic
900679813 1:3910596-3910618 CTGAGGGCTGCATGTTTTGAGGG + Intergenic
905280321 1:36845005-36845027 CTGAAGGCAGCGTATTTATATGG - Intronic
906197865 1:43940183-43940205 CTGAAGCCTTCATAATTTTTTGG + Intergenic
907265433 1:53257125-53257147 CTGAATACTGCATATCTTTGAGG - Intronic
907566927 1:55444172-55444194 GGGAAAGCTGCATATTTTTATGG + Intergenic
908920306 1:69182788-69182810 TTGAAGTCTGCATACCTTCAAGG + Intergenic
910123429 1:83815282-83815304 CTTAAGTCTGGTTATTATTAAGG + Intergenic
910557557 1:88552739-88552761 CTGAAGTCTGTAGATTTCTGGGG - Intergenic
910689610 1:89952688-89952710 TTGAAGGCATCATATTTTTAAGG + Intergenic
916654357 1:166860310-166860332 CTGACGTCAGTATATCTTTAAGG + Exonic
916930935 1:169577333-169577355 TTTGAGTCTGCATATTTTTCAGG - Intronic
917251343 1:173064719-173064741 CTGAAGTCTGTGTTTCTTTAGGG - Intergenic
919507833 1:198422042-198422064 CTGAAGGCTTCATATGTTTTGGG - Intergenic
919694839 1:200563959-200563981 CTGAAGTTTGCCTTCTTTTAAGG - Intronic
919701442 1:200635521-200635543 CTGATGTCTGTATTTTTTTTTGG + Intronic
919861963 1:201745586-201745608 CTGATGTGTGCATATGTTCAGGG + Intronic
921175764 1:212593107-212593129 ATGAACTCTTCATTTTTTTATGG - Intronic
921786156 1:219232168-219232190 CTGAAGTCTGTGAGTTTTTAAGG + Intergenic
924051321 1:240082193-240082215 CTGCAGGTTGCACATTTTTATGG + Intronic
924212675 1:241787024-241787046 CTGTAGTCTGCAAACTTTTTGGG - Intronic
1063391175 10:5650733-5650755 CTGCAGTCTGCCTATTCTTGGGG + Intronic
1065334167 10:24638267-24638289 GTGAAATCTGCTTATATTTAAGG - Intronic
1065508923 10:26457981-26458003 ATGAAATCTGGATATTTTTATGG + Intronic
1066265434 10:33772070-33772092 CTGCCGGCTGCCTATTTTTATGG - Intergenic
1066545435 10:36494916-36494938 CTGTATTCTGCATATTTTCATGG + Intergenic
1068037541 10:51779757-51779779 CTGCATTCTGAATGTTTTTAAGG + Intronic
1068383647 10:56294299-56294321 CTCAAATCTGCTCATTTTTAGGG - Intergenic
1069161596 10:65100241-65100263 TTGAAATTTACATATTTTTAAGG + Intergenic
1069315564 10:67096583-67096605 CTGAAATCTGCCTACTTTTTAGG + Intronic
1070186085 10:74064003-74064025 CTGAAGTGAGGATAGTTTTATGG - Intronic
1072512749 10:96144660-96144682 GTGCAGTCTGTATAATTTTAAGG + Intronic
1073728224 10:106259374-106259396 ATGAACTCTTCATTTTTTTACGG - Intergenic
1074032523 10:109702900-109702922 CTTAAGTTTCCATATTGTTATGG - Intergenic
1074387724 10:113030194-113030216 TTGAAGTTAGCATATTTTCAAGG + Intronic
1075528909 10:123210336-123210358 CAGAAATCTGGTTATTTTTATGG + Intergenic
1075760421 10:124851204-124851226 CAGATGTCTGCATATATTTGGGG + Intergenic
1077747208 11:4919855-4919877 CTGATTTCTGCATACTCTTAGGG + Intronic
1078882426 11:15465379-15465401 CTAAATTATGCAGATTTTTATGG + Intergenic
1079599827 11:22297488-22297510 GTGAAGTGTGCATGTATTTATGG - Intergenic
1079676311 11:23231187-23231209 GGGAAGTCTGCATAAGTTTAGGG + Intergenic
1079858659 11:25639360-25639382 CTGAAGTCCCCAGAATTTTAGGG - Intergenic
1080477781 11:32612190-32612212 TTGGAATCTGCATCTTTTTAAGG + Intronic
1080590711 11:33721003-33721025 CAGCAGTCTGCATTTGTTTATGG - Intronic
1080691041 11:34558347-34558369 CTGAAATATGCATATCCTTAAGG - Intergenic
1080841453 11:35987215-35987237 CTGAAGTCTGCATATTTTTAGGG + Intronic
1083032097 11:59602354-59602376 CTGAAGGCTCCTAATTTTTAAGG - Intronic
1084836892 11:71808745-71808767 GTGAAGTTTTCATATATTTAGGG - Intergenic
1085650930 11:78267951-78267973 CTCATGTTTTCATATTTTTATGG + Intronic
1086244125 11:84730859-84730881 CTGATGTCTTCACAGTTTTAGGG - Intronic
1089010470 11:115128024-115128046 CTAAAGTCTCCATACCTTTAAGG + Intergenic
1089246433 11:117124043-117124065 CTGAAGGCTGCAGATATTAAAGG + Intergenic
1090580089 11:128149895-128149917 GTTATGTATGCATATTTTTAAGG - Intergenic
1090644912 11:128759632-128759654 CTAAAGCCTGCACATTTTAAAGG + Intronic
1090910721 11:131117084-131117106 CTGAAGTCATCCTTTTTTTATGG - Intergenic
1091059779 11:132450459-132450481 GTGGTGTCTGCAGATTTTTAGGG + Intronic
1092050168 12:5463602-5463624 CTGAAGGGTGCAAATTATTAAGG + Intronic
1092402341 12:8187359-8187381 GTGAAGTCTTCATATATTTAGGG + Intronic
1092901507 12:13064159-13064181 CTGAAGCCTACTTAGTTTTAAGG + Intronic
1092945748 12:13452606-13452628 CTGAAATCTGCAGATTAATATGG + Intergenic
1093735790 12:22618769-22618791 CTGCAGATTGCCTATTTTTATGG - Intergenic
1093937136 12:25013175-25013197 GCCAAGACTGCATATTTTTAAGG - Intergenic
1095223166 12:39643380-39643402 CTCAGCTGTGCATATTTTTAAGG + Intronic
1095246633 12:39930770-39930792 CTGAAGTCAGAATATTTATGTGG - Intronic
1095666834 12:44811998-44812020 CTGAAGGATGCTTATTTTTCTGG - Intronic
1096274678 12:50195968-50195990 CTGGAGTCAGCAGGTTTTTATGG - Intronic
1097902743 12:64889624-64889646 ATGAAGTTTGCATATCTTTAGGG - Intergenic
1098754071 12:74335546-74335568 CTGAAATCTGAATATTCTTAGGG + Intergenic
1099247368 12:80209347-80209369 TAGAAGTATGCATATTTGTAGGG - Intergenic
1099506526 12:83483754-83483776 CTGAAATTTTAATATTTTTAAGG - Intergenic
1099644364 12:85332738-85332760 CTGAAATGTACATATTTATATGG - Intergenic
1100225229 12:92549726-92549748 CTGAAGTCTGAACAATTATAAGG - Intergenic
1102636354 12:114327846-114327868 CTGTTGCCTGCATATTATTATGG + Intergenic
1103990236 12:124794253-124794275 CTGAATTGTGCATTTTATTAGGG + Intronic
1105358402 13:19681684-19681706 CTGAAGTCTGCAGATTTTGGTGG + Intronic
1106806974 13:33319496-33319518 CTGAAGTGTGCATTTTATAAGGG + Intronic
1107635599 13:42389247-42389269 ATGAAGGCTGTATATATTTAAGG + Intergenic
1107850372 13:44566139-44566161 ATGAAGCCTGCCTATTTTTTAGG + Intronic
1109008774 13:56912211-56912233 CTGAAGTCTACATATTGCTAAGG + Intergenic
1110420828 13:75306032-75306054 CTGAATTATTAATATTTTTATGG + Intronic
1111027248 13:82545323-82545345 ATGAGGTGTGCATATGTTTATGG - Intergenic
1111622666 13:90744531-90744553 CAGAAGCAGGCATATTTTTAAGG - Intergenic
1112559954 13:100503900-100503922 CTGAAGACTGCTTATTATTGAGG - Intronic
1113017295 13:105841574-105841596 CTGAAGTTTGCATTTTTACATGG + Intergenic
1113271808 13:108682798-108682820 CTGAAGTCTTGCTCTTTTTATGG + Intronic
1114024429 14:18512059-18512081 CAGAAGTCTGCACAGTTTTCTGG - Intergenic
1115111642 14:29830535-29830557 CTTAAGTCTGCTGATTGTTATGG - Intronic
1115579304 14:34742667-34742689 CTGAAGTGTGCATGCGTTTAGGG - Intergenic
1116290741 14:43035592-43035614 TTGAAGACTTCATATTATTAAGG - Intergenic
1120657910 14:87217519-87217541 CTGAAGCCTGCATATAAGTAAGG - Intergenic
1123578817 15:21698036-21698058 CTGATGTCTGCCTAATTTTGGGG + Intergenic
1123615444 15:22140518-22140540 CTGATGTCTGCCTAATTTTGGGG + Intergenic
1124087948 15:26569106-26569128 CTGTAGAATGCATATATTTAGGG - Intronic
1125071634 15:35561658-35561680 CAAATGTCTGGATATTTTTAAGG - Intergenic
1125775047 15:42204900-42204922 GTGAAGTCTGCATTTTTTACAGG + Intronic
1126062779 15:44799857-44799879 CTGTAGTTTGCATATCTTTCTGG + Intergenic
1127706076 15:61548418-61548440 CTGAAATCAGCACATTTTTGTGG - Intergenic
1128122470 15:65163032-65163054 CTGAAATCTTCATTTTTATAAGG - Intronic
1128231211 15:66036742-66036764 CTGAATTCAGCTTATGTTTAAGG - Intronic
1129511670 15:76128281-76128303 TTGAATTCTGCCTTTTTTTAGGG + Intronic
1130203038 15:81851057-81851079 CTGAACTCTGCATTTCTCTAGGG - Intergenic
1130238064 15:82157012-82157034 AAAAAGTATGCATATTTTTAAGG - Intronic
1202987687 15_KI270727v1_random:432281-432303 CTGATGTCTGCCTAATTTTGGGG + Intergenic
1135916372 16:26608969-26608991 CTGCTGGTTGCATATTTTTATGG + Intergenic
1136180146 16:28546182-28546204 CTCCAGTCTGCAAATGTTTAGGG + Intergenic
1140831626 16:78756889-78756911 CAGAAGCCTCAATATTTTTATGG - Intronic
1140991427 16:80216319-80216341 ATGAAGTCTGGATACTTCTAGGG - Intergenic
1143361159 17:6372389-6372411 CAGATGTGTGCATATCTTTATGG - Intergenic
1143469355 17:7162080-7162102 CTGAAGTATGCACATTATAAGGG + Intergenic
1145823188 17:27856343-27856365 TAGAAGTCTTCATTTTTTTATGG - Intronic
1146765198 17:35514399-35514421 CTGAAGAATGCACATTTTTACGG - Intronic
1149461238 17:56831867-56831889 CTGAAGTCTGCAGATTTCATAGG - Intronic
1149792621 17:59492676-59492698 CTCAAGTCTCCTTGTTTTTAGGG + Intergenic
1153594559 18:6711564-6711586 CTTAAGTATGCATATTTTATTGG - Intergenic
1155738616 18:29256497-29256519 CTGAAGTGGCCATATTTTCAAGG - Intergenic
1156231128 18:35154783-35154805 AAGCTGTCTGCATATTTTTAAGG + Intergenic
1156668158 18:39433682-39433704 CTGAAGTCAGCTTAATTTAATGG + Intergenic
1156794459 18:41025945-41025967 CTGATGTTTGCAGAATTTTAAGG + Intergenic
1158047108 18:53169621-53169643 CTGAGTTCTGCATATTTGAAGGG + Intronic
1158206400 18:54998030-54998052 TTGAACTCTGAATATTTTAATGG + Intergenic
1159138737 18:64367484-64367506 CTGAATTGTGCACTTTTTTATGG - Intergenic
1159439825 18:68463975-68463997 CAGAATTATGCATATTTATAAGG + Intergenic
1164000132 19:21090800-21090822 CTGATGGTTGCACATTTTTATGG + Intronic
1164272112 19:23682213-23682235 CTGAAGTTAGCATATTCTTAGGG - Intronic
1166838772 19:45683509-45683531 CTTAAGTGTGCATATGTGTAGGG - Exonic
925586213 2:5467146-5467168 ATGAAGTCCGCTTAATTTTATGG + Intergenic
926145112 2:10392354-10392376 CTGAATTCTACAAATATTTAAGG - Intronic
926245908 2:11122288-11122310 CTGCTGGCTGCACATTTTTATGG + Intergenic
926769849 2:16360949-16360971 GTAAAGTCTGCATATTTTCTAGG + Intergenic
927927825 2:27025608-27025630 CAGAGGTCTGCATGTTTTTTGGG - Exonic
928605730 2:32944103-32944125 CTGCATTCTGCATTTTTTAATGG + Intergenic
928808492 2:35192016-35192038 GTGAACTCTGCAGATATTTAAGG - Intergenic
928819785 2:35346482-35346504 CAGAAGACTGAATATTTTTGGGG + Intergenic
929253916 2:39789273-39789295 CTTAAAACTGCATATATTTAAGG - Intergenic
930592895 2:53350627-53350649 GTGAAGTAAGTATATTTTTAGGG - Intergenic
931036387 2:58248774-58248796 TTGAATTCTCCATATTTTTTGGG + Intergenic
932900532 2:75693938-75693960 ATTAAGTCTAAATATTTTTAAGG - Intronic
933122102 2:78551524-78551546 CTGAAGTCTTTATATTACTAAGG + Intergenic
933621790 2:84551665-84551687 CAGAAATATGCACATTTTTAAGG + Intronic
939332777 2:140786290-140786312 CTAAAGGCAGCATATTTGTAAGG + Intronic
939907395 2:147933794-147933816 CCGTAGTCTACACATTTTTAGGG - Exonic
940121145 2:150267753-150267775 CTGAAATCTGCACATTCTCAAGG - Intergenic
940130623 2:150377447-150377469 CTGAAATCCTCATATTTTTCAGG + Intergenic
940233289 2:151482356-151482378 CTGATTTATGCATAGTTTTATGG + Intronic
940726249 2:157340044-157340066 CTGCAGGTTGCCTATTTTTATGG + Intergenic
941181819 2:162268462-162268484 CTGAAGACTGCACATTTTCATGG - Intronic
941958042 2:171224591-171224613 CTGAAGTCTTAATATCATTAAGG + Intronic
942204423 2:173605238-173605260 CTGAAGTCTGCATGGGTTGATGG + Intergenic
943877621 2:193092171-193092193 CAAAAGTTTGCATTTTTTTAAGG - Intergenic
943963021 2:194291544-194291566 CTAAAAACTGCATATTGTTATGG - Intergenic
944981047 2:205120405-205120427 CTTAATTCTGCAAATTGTTAGGG - Intronic
945911554 2:215655704-215655726 TTGAAGTTTCCATGTTTTTATGG - Intergenic
946657491 2:221964059-221964081 CTGAAGTGGCCATATTTTCAAGG + Intergenic
947016241 2:225623035-225623057 ATGAAGTCTACATATTTTTTTGG - Intronic
947041626 2:225928501-225928523 CATAAGTCTTCATTTTTTTATGG + Intergenic
1169040048 20:2486114-2486136 CTGCAGTCTGAATATATATACGG + Intronic
1169496794 20:6123129-6123151 GCGCAGTCTGCAGATTTTTAAGG + Exonic
1169993421 20:11528973-11528995 CTAAATTCTGAATATTTTTATGG - Intergenic
1171359824 20:24579311-24579333 CTGAAGTCTTGCTCTTTTTATGG + Intronic
1173148673 20:40547245-40547267 CTGGAGGCTGCATGGTTTTATGG - Intergenic
1175415544 20:58798383-58798405 CTTATGTTTGTATATTTTTATGG - Intergenic
1178247100 21:30963900-30963922 CTGAAGTCAACATATTTTCCAGG + Intergenic
1178944934 21:36939235-36939257 CTGAAGTCTCCACCTTTTTAAGG + Intronic
1180448595 22:15439586-15439608 CAGAAGTCTGCACAGTTTTCTGG - Intergenic
1181516025 22:23413987-23414009 CTGATGTATCCATATTTGTATGG + Intergenic
1181658335 22:24319599-24319621 CTGAATTCTGCCTATCTTTTGGG + Intronic
1183919883 22:41157118-41157140 CTCAAGTCTCACTATTTTTACGG - Intronic
1185243421 22:49759518-49759540 CTGAATTCTGTATTTTGTTAAGG - Intergenic
950671419 3:14528234-14528256 CAGTAGTTTGCATCTTTTTATGG + Intronic
951633117 3:24742701-24742723 CTGGAGTCTGCAGAGTATTAAGG - Intergenic
952557757 3:34552679-34552701 CTGAAGTCACCAAGTTTTTAAGG + Intergenic
952659795 3:35831741-35831763 CTCAAGTCTGCACATTCTTTAGG - Intergenic
954193572 3:48982493-48982515 TTTAAGTTTGAATATTTTTAAGG + Intronic
955284866 3:57630494-57630516 CTAAAGTCTCCAAATTTTGATGG - Exonic
955578747 3:60395915-60395937 CTGTAGTCTGTGTCTTTTTAAGG - Intronic
955821396 3:62899668-62899690 ATGTATTCTGAATATTTTTATGG + Intergenic
956658102 3:71572000-71572022 GTGATTTCTGCATATTTTAAAGG - Intronic
957383118 3:79460252-79460274 CTGTAGTCTCCATATATTGATGG - Intronic
958147658 3:89647405-89647427 CCTAAGTTTGAATATTTTTATGG + Intergenic
959388081 3:105738176-105738198 CTGTAGTATGTATATTTTAAAGG + Intronic
959432756 3:106275218-106275240 CTGAATTCTGAATAGTTTTGGGG - Intergenic
959680960 3:109096035-109096057 TTGAAGTTTTCATCTTTTTATGG - Intronic
962481169 3:135799996-135800018 GAGAACTCTGCTTATTTTTATGG + Intergenic
962945102 3:140161339-140161361 ATGAAGTTTGCTTATTTTTATGG + Intronic
963406399 3:144868999-144869021 CTCAAGACTGAATATTTTTCTGG - Intergenic
964184582 3:153927582-153927604 CTGAAGCCTGCATAGGTTTCGGG - Intergenic
964432097 3:156617919-156617941 CTGGATTCTGGATATTTTGAAGG + Intergenic
964493718 3:157265818-157265840 CTGAATTGTGCATTCTTTTAGGG - Intronic
965569515 3:170157473-170157495 CTGTAGCCTGAATATTTGTATGG - Intronic
965760198 3:172067727-172067749 CAGAAGTTTGCATCTTGTTAGGG + Intronic
965967933 3:174518908-174518930 TTGTATTCTGCATTTTTTTAAGG + Intronic
966813166 3:183866632-183866654 CTGAAGTCTCCTTCTTTTTGTGG + Exonic
969778294 4:9376240-9376262 GTGAAGTTTTCATATATTTAGGG - Intergenic
970018462 4:11539554-11539576 CTGTAGTTAGCATTTTTTTATGG - Intergenic
972441979 4:39103315-39103337 CTGGAGTCCACATATTTGTACGG - Exonic
972748432 4:41964311-41964333 TTGAAGTGTGCATTTTTGTATGG + Intergenic
973157518 4:46975354-46975376 CTGAAGTGTGAATATATTTCTGG - Intronic
974303377 4:60098798-60098820 CTGAAGTTTAGAGATTTTTATGG - Intergenic
976123608 4:81809414-81809436 CAGAAGCCTGCTTATATTTATGG - Intronic
976767185 4:88609868-88609890 CTGCTGATTGCATATTTTTATGG + Intronic
976985833 4:91296405-91296427 GTAAAGTCTTCATATTTTTCTGG + Intronic
977328927 4:95612037-95612059 CTCAAGTTTTCATAATTTTAGGG - Intergenic
978558486 4:110006415-110006437 CAGAAGTCTGCATAGGTTAAAGG - Intronic
979634977 4:122946393-122946415 TTTTAGTCTGAATATTTTTAAGG + Intronic
980509703 4:133770155-133770177 CTGAAATATGCATTTTATTAAGG + Intergenic
980716391 4:136635902-136635924 CTGATGGTTGCCTATTTTTATGG + Intergenic
980832083 4:138143064-138143086 CTGAAGTATGAATATGTTTGAGG - Intergenic
980985452 4:139690626-139690648 AGGATGTGTGCATATTTTTATGG + Intronic
982438476 4:155404480-155404502 CTGAATTGTGCATTATTTTATGG + Intergenic
982521319 4:156419907-156419929 CAGAAACCTGCATCTTTTTAGGG - Intergenic
982864560 4:160493685-160493707 CTGCAGGCTGGCTATTTTTATGG - Intergenic
983033595 4:162835122-162835144 CTAAATGCTGCATATTATTATGG + Intergenic
983044783 4:162973157-162973179 CTGCTGGCTGCCTATTTTTATGG - Intergenic
983401216 4:167268549-167268571 CTGCTGGTTGCATATTTTTATGG - Intergenic
983818769 4:172167511-172167533 CTGAATTCTTCATATTTACATGG - Intronic
984205178 4:176778859-176778881 TTGAAATCAGCATTTTTTTAGGG - Intronic
984276604 4:177618549-177618571 ATGAATTTTGAATATTTTTATGG - Intergenic
985359243 4:189155116-189155138 GTGAGGTCTGGATATTCTTAGGG - Intergenic
985378385 4:189366170-189366192 CTCAAGTCTCCAAATTTATAAGG + Intergenic
985499636 5:234545-234567 AAAAAGTCTGCATATTTGTAAGG - Intronic
985974674 5:3407606-3407628 ATGAACTCTTCATTTTTTTATGG + Intergenic
987504711 5:18753041-18753063 TAGAAATCAGCATATTTTTAAGG + Intergenic
988347572 5:30058007-30058029 CTGAAGTATGCATATCCTTTTGG - Intergenic
989755716 5:44950829-44950851 CTGCACACTGTATATTTTTATGG + Intergenic
989783646 5:45301158-45301180 TTAAAGTCAGCATATTATTAAGG + Intronic
990353451 5:54941423-54941445 CTGAAATCTGCTTTTTTTTGAGG - Intergenic
990955568 5:61334850-61334872 CTAGAGTCTGCGAATTTTTATGG + Intronic
992006782 5:72486248-72486270 CTCAAGTCTGCCTATTTTTCAGG - Intronic
993121985 5:83786161-83786183 CTGATGTTTGGATATTTTTAAGG + Intergenic
993185837 5:84618418-84618440 CTGAATTCTGCATTGTTATAAGG + Intergenic
993201716 5:84825204-84825226 CTCTAGTCTGTATATTTTTCAGG + Intergenic
994506023 5:100643835-100643857 CTGAGTTCTTCATATATTTAAGG - Intergenic
994519549 5:100814923-100814945 TTGAAAACTGCAAATTTTTATGG + Intronic
994841216 5:104927654-104927676 CTGAAGTCTGCATTCATTTTTGG - Intergenic
996428231 5:123338722-123338744 CTAAATACTGCATATTTTTATGG + Intergenic
996662414 5:126020106-126020128 GGGAAAACTGCATATTTTTATGG + Intergenic
996997244 5:129712785-129712807 CTGAAGTATACATTTTTTTAGGG - Intronic
997229321 5:132231226-132231248 CTCAAGGCTGCAGATTTTTTAGG - Intronic
997992375 5:138555724-138555746 CTGAAGTGACCATATTTTCAAGG - Exonic
998487497 5:142515962-142515984 ATGAACTCTTCATTTTTTTATGG - Intergenic
998977101 5:147660571-147660593 CTAAAGTCAGCATGTTTTTGTGG - Intronic
1000102354 5:158028343-158028365 CTGAAGTCCAGATAGTTTTAGGG - Intergenic
1000450384 5:161379143-161379165 CTGAAGACCTCATCTTTTTAAGG - Intronic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1004523740 6:16386353-16386375 CTGAACTCCCCATTTTTTTATGG - Intronic
1004748607 6:18538078-18538100 CTAAAGTCAGCATATATTTTCGG + Intergenic
1006587175 6:35123293-35123315 CTCAAGTTTGCATGTGTTTAAGG - Intronic
1007606232 6:43119999-43120021 CAAAAGTCTGCCTATTTTTCAGG - Intronic
1008006304 6:46413276-46413298 CAGAAGTGTGCATCTTTTAAAGG + Intronic
1008684742 6:53912615-53912637 TTGAAATCTTTATATTTTTAAGG + Intronic
1008821181 6:55632619-55632641 TTGAAGTATTCATATTTTTAGGG + Intergenic
1008828455 6:55728613-55728635 CTGAAGACTTCCTCTTTTTATGG + Intergenic
1010519228 6:76811846-76811868 CTAAAGTCTACAAATTTTAAGGG - Intergenic
1010567596 6:77435471-77435493 TTAAAGTTTCCATATTTTTATGG + Intergenic
1011171598 6:84510798-84510820 CTGGACTCTGTATAATTTTATGG - Intergenic
1011419132 6:87153523-87153545 ATCAAGTCTCCATAGTTTTAGGG + Intronic
1011583169 6:88894712-88894734 CTGAAGTGGCCATATTTTCAAGG - Intronic
1012109412 6:95209203-95209225 CTGAAGTAAGCATATCTTTTGGG + Intergenic
1012850741 6:104444027-104444049 CTGAAGACTGTGTGTTTTTAAGG - Intergenic
1013837459 6:114349286-114349308 CTGATGTCAACATATATTTAGGG + Intergenic
1014169285 6:118261329-118261351 TTGCAGTAAGCATATTTTTATGG - Intronic
1015932187 6:138372660-138372682 CTAAAATCTGTAGATTTTTAAGG - Intergenic
1016006324 6:139092599-139092621 CTGATGGCTGCCCATTTTTATGG - Intergenic
1016368325 6:143342680-143342702 CTGAAGTCTCCTTCTTTTTGTGG - Intergenic
1016981489 6:149858893-149858915 CAGAAGTATGAATATTTTAATGG + Intronic
1018565857 6:165152005-165152027 ATGAATTCTTCAAATTTTTAAGG + Intergenic
1020967045 7:14884157-14884179 CTTTCGTTTGCATATTTTTAGGG - Intronic
1021154709 7:17195583-17195605 GTGAAGTTTCCATATTTTTCTGG - Intergenic
1021980969 7:26055360-26055382 CTGAAGCCTGCATATCATCAAGG + Intergenic
1022002756 7:26241537-26241559 ATGTAGTATGCACATTTTTAAGG + Intergenic
1023155088 7:37242286-37242308 CTGACATCTGGTTATTTTTATGG + Intronic
1023176017 7:37436366-37436388 CTGAAGACTGTATATTTGTCAGG + Intronic
1023367842 7:39482355-39482377 CTGAAGTTTGAATATGATTATGG + Intronic
1023608499 7:41951340-41951362 CTGACCTCTGCAGATTTGTATGG + Intergenic
1024081337 7:45858524-45858546 CTGATGGTTGCCTATTTTTATGG + Intergenic
1024359395 7:48452910-48452932 ATTAAGTCTGCATATTTATTAGG - Intronic
1025265718 7:57455218-57455240 CTGAAGTCAGCATGTTCTTAAGG + Intronic
1025719076 7:63992954-63992976 CTGAAGTTAGCATGTTCTTAAGG + Intergenic
1025747223 7:64253796-64253818 CTGAAGACAGCATGTTTTTAAGG + Intronic
1026865468 7:73821558-73821580 CTGAAGCCTGGAGGTTTTTATGG + Intronic
1027717196 7:81687729-81687751 CAGAATTCTTCATAATTTTAAGG - Intergenic
1027889715 7:83956174-83956196 GTGAAGTCTGCATTTGTTCAAGG - Exonic
1028748463 7:94354794-94354816 CAGAAGTCTGCATATTTCCTGGG + Intergenic
1030249387 7:107425617-107425639 CTAAGGTCTGCAAATTTTAAGGG + Intronic
1030422504 7:109326033-109326055 CTGAAGTATACATATTTATTGGG + Intergenic
1030670527 7:112331023-112331045 CTTCAGTCAGCTTATTTTTAAGG + Intronic
1033895220 7:146060660-146060682 CTGAAATCTGCAAACTTTTGAGG - Intergenic
1034145083 7:148863164-148863186 ATGATGTCTGGATATATTTAAGG - Intronic
1035993444 8:4518362-4518384 ATGAAGTCCTCATATTTTTAAGG - Intronic
1036275750 8:7350236-7350258 GTGAAGTTTTCATATATTTAGGG - Intergenic
1036345605 8:7960120-7960142 GTGAAGTTTTCATATATTTAGGG + Intergenic
1036407517 8:8468390-8468412 CTGCACTCTGCACAGTTTTAGGG + Intergenic
1036840931 8:12120876-12120898 GTGAAGTTTTCATATATTTAGGG + Intergenic
1036862739 8:12367126-12367148 GTGAAGTTTTCATATATTTAGGG + Intergenic
1037512022 8:19593373-19593395 GTGAAGTCTGCATCATTTTGTGG + Intronic
1038903230 8:31867694-31867716 CTGAAATCAGCACATTTTTCTGG + Intronic
1038994357 8:32904812-32904834 TTGAGGTCAGCAGATTTTTATGG + Intergenic
1039240399 8:35549813-35549835 CAGAATTCTGAATATTTTTGAGG + Intronic
1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG + Intergenic
1041098835 8:54376270-54376292 CTGAATTCTGTTTCTTTTTAAGG + Intergenic
1041128258 8:54667239-54667261 CTGCAGTCTTCCTATTTGTAAGG - Intergenic
1042684444 8:71422499-71422521 CTGTGGTCTGTATATTCTTAGGG + Intronic
1042765658 8:72318707-72318729 CTGAAGTGGGCATTTTTTTCTGG - Intergenic
1042822616 8:72947320-72947342 GTGAAGTCTTAATAATTTTAAGG - Intergenic
1043823877 8:84901689-84901711 CTGAAGCCAGCATATTTTCCAGG + Intronic
1044243093 8:89910056-89910078 CAGAAGTCTGCAGAGTTGTAAGG - Intronic
1044884703 8:96764857-96764879 CTGAACTCTACATATTTTAAAGG - Intronic
1045157983 8:99500962-99500984 CTGAACTCTGAATATGTATAAGG - Intronic
1045720284 8:105101796-105101818 CTGAATCCTGCCTATTTTCAGGG - Intronic
1046981546 8:120341827-120341849 CTGAAGTCAGCTTAATTTAAGGG + Intronic
1050125768 9:2354976-2354998 TTAAAGTCTGCAGATTGTTATGG - Intergenic
1050201529 9:3150134-3150156 CTGCAGCCTGGAAATTTTTAAGG - Intergenic
1052165312 9:25319284-25319306 ATGAACTCATCATATTTTTATGG - Intergenic
1055536984 9:77258175-77258197 CTGAGGTCTGAATATTTGTAAGG - Intronic
1055815066 9:80195385-80195407 CTAAAGTCTGCAAATTTTTAGGG + Intergenic
1056282535 9:85055933-85055955 CAGAAGTCTGAATGTTTTGATGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057459755 9:95250485-95250507 ATGAAGACTGCACATTTTTTAGG - Intronic
1057809168 9:98244357-98244379 GCCAGGTCTGCATATTTTTAAGG - Intronic
1058395704 9:104551476-104551498 CTGAAATATGCATAATATTATGG + Intergenic
1185859738 X:3566457-3566479 CTGCAGGCTGCCTATGTTTATGG + Intergenic
1185942122 X:4333469-4333491 CTGTAGTCTGGATATGGTTATGG - Intergenic
1186244025 X:7601462-7601484 TTGAAGTCTTCATATTTGTGAGG + Intergenic
1186445057 X:9620292-9620314 CTGAAGTTTGTATATTTATCCGG + Intronic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1194050951 X:89068240-89068262 ATAAAGACTGAATATTTTTATGG - Intergenic
1194712817 X:97255799-97255821 CTGAATGGAGCATATTTTTAAGG + Intronic
1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG + Intronic
1195673364 X:107487461-107487483 CTGTAGTCTGGATATTCTCATGG + Intergenic
1195904911 X:109834842-109834864 CAGAAGTCAGCATATATTTTTGG + Intergenic
1196015167 X:110931635-110931657 TTGAAGTCTCAATATTGTTAAGG + Intergenic
1196161935 X:112494833-112494855 CTGCAGTTTGGCTATTTTTATGG + Intergenic
1196893997 X:120315615-120315637 ATCAAGTCAGAATATTTTTAAGG + Intergenic
1197199697 X:123737464-123737486 CTGAAATCTAGCTATTTTTAAGG + Intergenic
1197848241 X:130827813-130827835 GTGAAGTGTGCATGTGTTTATGG + Intronic
1199031727 X:143008029-143008051 CTGAAGTATGCATAGCTCTATGG - Intergenic
1199075615 X:143521949-143521971 ATGAAGTCATCATTTTTTTATGG + Intergenic
1199532717 X:148868290-148868312 ATGGAGTCTGCAGATTTTTGTGG - Intronic
1199708491 X:150451368-150451390 CAGAAGTGTGCACATTTCTAGGG + Intronic
1199827455 X:151514837-151514859 CTGAAGTCTTCATAGTCTGAAGG + Intergenic
1202246348 Y:22824148-22824170 CTGAGGTCTGCATGCTTGTATGG - Intergenic
1202399336 Y:24457896-24457918 CTGAGGTCTGCATGCTTGTATGG - Intergenic
1202471444 Y:25212190-25212212 CTGAGGTCTGCATGCTTGTATGG + Intergenic