ID: 1080845179

View in Genome Browser
Species Human (GRCh38)
Location 11:36020742-36020764
Sequence GTGGGCTGGCCAGGATACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080845179 Original CRISPR GTGGGCTGGCCAGGATACCC AGG Intronic
900653623 1:3743971-3743993 GTGGGCTGGACAGGAGCCCGGGG + Intergenic
900932628 1:5746657-5746679 GTGGGCTTCCCAGGCTTCCCAGG + Intergenic
901635016 1:10666480-10666502 GTGGGCTGGCCAGGCCTTCCGGG - Intronic
901649092 1:10733148-10733170 GAGGGCAGGCCAGGCTTCCCAGG + Intronic
903147417 1:21383531-21383553 GCGGGCTGGACTGGACACCCAGG - Intergenic
903189908 1:21650731-21650753 GTTGGCTGGCCAGGAAGCTCAGG + Intronic
905887466 1:41499113-41499135 GTGTGCTGGCCAGGATGTGCAGG + Intergenic
908445561 1:64196487-64196509 GTGGCCAGGCCCAGATACCCAGG + Intergenic
912365296 1:109128554-109128576 GGGGGCTGGCAAGGATGCCTTGG - Intronic
913103980 1:115595093-115595115 GTGGGCTCGCCAGTCTAACCAGG + Intergenic
914341229 1:146762226-146762248 TTGGGCAGGGCAGGAGACCCAGG - Intergenic
916091166 1:161308930-161308952 GGGGGCTGGCCAGAATGCCCAGG - Intronic
917456573 1:175191182-175191204 GTGTGCAGGCCAGTATACCAGGG - Intronic
917906097 1:179588352-179588374 GCAGGCTGGCCAGGATGGCCAGG - Intergenic
919743533 1:200994680-200994702 GTGAGCTGGCCAGGACACGATGG + Intronic
921046448 1:211481212-211481234 GCTGGCTGGCCAGCACACCCCGG - Exonic
922740878 1:228013640-228013662 GTGAGCCGGCCAGGGTCCCCAGG - Intronic
924708729 1:246517941-246517963 GTGGGCTGGCCTTGTGACCCTGG + Intergenic
1063370992 10:5523209-5523231 ATGGGCTGGCCAGGACTCCCTGG - Intergenic
1063610918 10:7561381-7561403 GGGAGCTGGCCAGGCTCCCCGGG - Exonic
1065502396 10:26395039-26395061 GTGGGGTGGCCAGCTTCCCCAGG + Intergenic
1066538997 10:36423821-36423843 CTGGCCTGGCCATGATAACCTGG - Intergenic
1069177078 10:65304927-65304949 GTGGTTTTGCCATGATACCCAGG + Intergenic
1069907553 10:71740673-71740695 CAGGGCTGGCCAGGCCACCCAGG + Intronic
1072743521 10:97924335-97924357 CTGGGCTGGACAGGAAACACAGG + Intronic
1073018263 10:100419431-100419453 GAGGTCTGGCCACGTTACCCAGG - Intergenic
1074191287 10:111139787-111139809 GTGGGCCGGCCACGGTGCCCGGG + Intergenic
1075107163 10:119547883-119547905 GTGGGGTGGCCAGCCTTCCCTGG - Intergenic
1077505293 11:2927331-2927353 GTGGGCCAGCCAGGAGGCCCAGG + Intergenic
1080264221 11:30384744-30384766 CGCGCCTGGCCAGGATACCCAGG + Intronic
1080845179 11:36020742-36020764 GTGGGCTGGCCAGGATACCCAGG + Intronic
1084565386 11:69925609-69925631 GTGGGCTCCCCAGGACACCTGGG - Intergenic
1084713415 11:70858434-70858456 GTGGGCTAGACTGGAAACCCAGG + Intronic
1087651715 11:100875639-100875661 GTGGCCAGGCCCAGATACCCAGG + Intronic
1089291973 11:117443058-117443080 GTAGGCTGGCCAGGCTGCGCAGG + Intronic
1091668245 12:2434669-2434691 GTGGGCTGGCCAGTGACCCCAGG - Intronic
1092757621 12:11778283-11778305 GTGCGCTCGCCAGGCTGCCCAGG - Intronic
1093372316 12:18379730-18379752 CAGGGCTTGCCAGGAAACCCTGG - Intronic
1094206371 12:27844659-27844681 GCGGGCTGGCAAGGCTGCCCGGG - Intergenic
1096465223 12:51844922-51844944 GTGGGGAGGTCAGGAAACCCAGG + Intergenic
1097069338 12:56343457-56343479 GTTGGCTGGCCAGAACACCGTGG - Exonic
1097191382 12:57221163-57221185 GTGGGGTGGACAGGACAGCCTGG - Intronic
1100724681 12:97396124-97396146 GAGGTCTGGCTAGGTTACCCAGG - Intergenic
1100997056 12:100312925-100312947 GTGGTTTGGCCATGTTACCCAGG - Intronic
1103126989 12:118432303-118432325 GTGCGCTGTCCAAGGTACCCAGG - Intergenic
1103531877 12:121608108-121608130 GGGGTCTGGCCATGTTACCCAGG + Intergenic
1105435675 13:20376033-20376055 GTGGGCTGGCCGGGACAGTCAGG + Intergenic
1109042412 13:57356573-57356595 GTAGGTTGGGAAGGATACCCAGG + Intergenic
1112146749 13:96708680-96708702 GTGGCCTGGCCAGGATCCTTGGG - Intronic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1115648441 14:35385888-35385910 GGGAGCTGGCCAGGAGGCCCAGG + Intergenic
1117980155 14:61334891-61334913 ATGGGCTCGCCATGTTACCCAGG + Intronic
1121729788 14:96178454-96178476 GAGGTCTGGCCATGTTACCCAGG - Intergenic
1122342440 14:101037257-101037279 GGGGCCTGGCTAGGGTACCCAGG - Intergenic
1122458617 14:101877448-101877470 GTGTGCTGCCCAGAAGACCCGGG + Intronic
1124614135 15:31229386-31229408 GTGGGCTGGCTGGTGTACCCAGG + Intergenic
1125601886 15:40919817-40919839 GAGGGCTGGCCAGGAGAGCAAGG + Intergenic
1128080050 15:64851728-64851750 GTGGGGTGGAGAGGAGACCCAGG + Intronic
1129198200 15:73983446-73983468 GTGGGCCAGCCAGGATCCCCAGG + Exonic
1129606254 15:77026486-77026508 GTGGTATGGCCAGGACACCCAGG - Intronic
1130253527 15:82315453-82315475 GTGGGCTGGTCAGCATGCCAGGG + Intergenic
1130543860 15:84840657-84840679 GTGGGCTGGCCAGGAGCGCCAGG - Exonic
1130647887 15:85744705-85744727 GTGGGCTGGCCAGGATCAGGAGG - Exonic
1131032114 15:89195138-89195160 GTGAGCTGGCTAGGGTAGCCTGG - Intronic
1131111980 15:89770177-89770199 GTGGGGAGGGCAGGATGCCCTGG + Intronic
1131154339 15:90065486-90065508 GAGGGCAGGCCAGGAGAGCCGGG + Intronic
1132582120 16:689683-689705 GTGGGCTGGCCTGGTCAGCCTGG + Exonic
1132685302 16:1159574-1159596 GTGGGCTGGCCTGGGGGCCCAGG + Intronic
1132973454 16:2700227-2700249 GTGGGCTGGCCAGGAGGCTCTGG - Intronic
1133209797 16:4257144-4257166 GTGGGCTGGCCTGAAGACCAGGG - Intergenic
1134660190 16:15978176-15978198 GTGGTCTGGCCATGTTCCCCAGG - Intronic
1135740565 16:24971843-24971865 GTGGCCTGGCCAGGCATCCCAGG + Intronic
1139425678 16:66878618-66878640 GGAGGCTGGCCAGGCTGCCCAGG + Intronic
1139788008 16:69409673-69409695 GTTGGGTGGCCAGGATCCCTGGG + Intergenic
1139993055 16:70955182-70955204 TTGGGCAGGGCAGGAGACCCAGG + Intronic
1140898945 16:79350636-79350658 GTGGGCTGGAGAGGGTTCCCAGG + Intergenic
1142260311 16:89039725-89039747 CTGATCTGGCCAGGAGACCCAGG - Intergenic
1142687389 17:1585577-1585599 GGGGGCTGGCCATGTTTCCCAGG + Intronic
1143370699 17:6437216-6437238 GGGATCTGGCCAGGATTCCCTGG - Intergenic
1143573512 17:7776137-7776159 GTGGGCTGGCCAGGTGAGCTGGG + Exonic
1143614240 17:8039902-8039924 GTGGTCTGCCCAGGACACCTTGG - Exonic
1144581027 17:16459743-16459765 GAGGGCTGACCAGGACATCCTGG - Intronic
1145056494 17:19706969-19706991 GTGGACTGGCCAGGTGAGCCTGG - Intronic
1145760241 17:27421444-27421466 GTGGGCTGGCCTTGGGACCCTGG - Intergenic
1145798814 17:27670882-27670904 GTGGGCTGGCCTTGGGACCCCGG + Intergenic
1146160258 17:30555716-30555738 GTGGGCTGGCCTTGGGACCCTGG - Intergenic
1148089269 17:45013129-45013151 GGGGTGGGGCCAGGATACCCAGG - Intergenic
1148336068 17:46842036-46842058 CTGGGCTGGCCTGGGGACCCGGG + Intronic
1148800333 17:50221089-50221111 CTGCGCTGGGCAGGATGCCCGGG - Intergenic
1149420951 17:56510675-56510697 GGGGCCGGGCCAGGATCCCCAGG + Intronic
1149911810 17:60573744-60573766 GTGGTCTGGCCAGGGCAACCAGG - Intronic
1150705062 17:67478989-67479011 GAGGGCAGGCCAGGTTACCTCGG + Intronic
1151596039 17:75078476-75078498 ATGGCCTGGCCAGGGTCCCCTGG - Intergenic
1152911174 17:83005729-83005751 GGGTGCTGGCCTGGATGCCCGGG - Intronic
1156919535 18:42504149-42504171 GTGGGCTGGCCAGGAAAACTAGG - Intergenic
1156952163 18:42915260-42915282 TTGGGCAGGCAAGGATACCTGGG + Intronic
1157447510 18:47756327-47756349 GTGGGCTGGCCAGAAAACAGAGG - Intergenic
1157523443 18:48361107-48361129 GTAGCCTGGGCAGGAGACCCAGG + Intronic
1160671591 19:367198-367220 TTGGGCTGCCCTGGATACCTGGG + Exonic
1160681424 19:413226-413248 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681449 19:413300-413322 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1160681474 19:413374-413396 GTGGAGGGGCCAGGATGCCCCGG - Intergenic
1161585264 19:5102287-5102309 GTGGGCTTGCCAGCCTACCAAGG + Intronic
1162022461 19:7874092-7874114 GGGGGCTGGCGGGGAGACCCGGG - Intronic
1162456199 19:10786511-10786533 GTGGCATGGGCAGGATACCAGGG - Intronic
1162589379 19:11580708-11580730 GTGGTCTCGCCACGATGCCCAGG - Intronic
1163130414 19:15269099-15269121 CTGGGCTGGCCAGGCTGGCCTGG + Intronic
1165840860 19:38788584-38788606 TTGGGCTGCCCAGGATATGCAGG - Intergenic
1166079349 19:40434046-40434068 CTGGGCCGGCCGGGGTACCCGGG - Intergenic
1166561102 19:43732948-43732970 CTGGGGTGGCCACGATACCCAGG + Exonic
1168562098 19:57393152-57393174 GTGAGCTTGCCAGGAGACCTTGG - Intronic
925171672 2:1754062-1754084 GTGGCCTGGGCTGGAGACCCTGG - Intergenic
928419634 2:31128314-31128336 GAGGCATGGCCAGGACACCCCGG + Intronic
931687665 2:64808324-64808346 GTGGGGTGGCCAGCCTTCCCTGG + Intergenic
933085926 2:78053730-78053752 CTGGGCTGGGGAGGATCCCCAGG + Intergenic
934648396 2:96072609-96072631 GTGGCCTGGCCAGGGTCCCTCGG + Intergenic
935302544 2:101705379-101705401 GTGTGCTGGGCAGGGAACCCAGG - Intronic
937318593 2:120947576-120947598 GTCTGCTGGCCTGGAAACCCAGG - Intronic
939988481 2:148855366-148855388 GTGGGCTCTCCAGGAGGCCCAGG - Intergenic
940378796 2:152989180-152989202 GTAGGCTGGCAAAGATACCAGGG - Intergenic
945885927 2:215375352-215375374 GTGTGGTGGCCAGGAAACGCAGG + Exonic
946709840 2:222494497-222494519 GTGGGCTGGCAAGGTGACCTGGG - Intronic
947234904 2:227930560-227930582 GAGGGCTGGCCATGTTGCCCAGG + Intergenic
948027387 2:234789104-234789126 GTTGGCTGGTCAGGATTCACTGG - Intergenic
948879154 2:240847335-240847357 GTGGGCTGGCCAGGCAGCCAGGG + Intergenic
1168810156 20:699831-699853 GCAAGCTGGCCAGGATTCCCTGG + Intergenic
1168892322 20:1303004-1303026 GTGGTTTGGGCAGGATGCCCTGG + Intronic
1170743179 20:19075605-19075627 CTGGGCTGGGGAGGGTACCCAGG - Intergenic
1171426844 20:25054166-25054188 GTGGGATGGGCAGGATACTGTGG + Intronic
1172194439 20:33082758-33082780 ATGAGCTGGCCAGGATGCCAGGG + Intronic
1175242689 20:57561459-57561481 GTAGGCTGTCCAGGCTTCCCTGG - Exonic
1175822056 20:61915344-61915366 CTGGCCTTGCCAGGATGCCCTGG - Intronic
1176047727 20:63101354-63101376 GTGGGCTGTCCTGGAGACTCGGG + Intergenic
1176246923 20:64101961-64101983 GGGGGCTGGAGAGGAGACCCAGG - Intergenic
1178528971 21:33358810-33358832 GGGGTCTGGCCATGTTACCCAGG - Exonic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1179261109 21:39758662-39758684 GTAGTCTGACCAGGAGACCCAGG - Intronic
1179479056 21:41666281-41666303 GAGGGCTGCCCAGGAGACCTTGG + Intergenic
1179612322 21:42560305-42560327 GTGGGCTGGGCAGGCTGTCCAGG + Intronic
1179792263 21:43762511-43762533 GGGGGCTGGCCTGGGTGCCCCGG + Intergenic
1181015241 22:20064762-20064784 GTGGCTTGGCCAGCATCCCCCGG + Exonic
1181078713 22:20400033-20400055 GGGTGGTGGCCAGGATGCCCAGG + Intronic
1183409513 22:37646758-37646780 GTGGGCAGGGCAGGACACCCTGG - Intronic
1185012090 22:48319882-48319904 GTGGCCAGGCCAGGATGCTCTGG + Intergenic
954428923 3:50458912-50458934 GTGGGCTGGGCCAGAAACCCGGG - Intronic
955442761 3:58974788-58974810 GTGGGCTGGGCAAGAGAACCAGG - Intronic
955643249 3:61109508-61109530 GTGGGCTGGACAGGAGAACCAGG - Intronic
956779595 3:72593646-72593668 GTGGGCAGGCCAGGATGCTGGGG - Intergenic
966856339 3:184196473-184196495 GTGGTCTGGCCAGGAGAAACAGG - Intronic
968554652 4:1240770-1240792 GTGGGCTGTCCGGGGAACCCTGG - Intronic
968652393 4:1765433-1765455 GTGGGCTGGGCAGGAGGCCAGGG - Intergenic
972718766 4:41675301-41675323 GTGGGCTGGCCCAGGTACCCTGG + Intronic
975647823 4:76563029-76563051 GTGGTCTGGCCATCATACCACGG + Intronic
981005265 4:139867882-139867904 GTGGGATGGCCTGGCTGCCCCGG + Intronic
984713333 4:182904007-182904029 TTGGGCAGGCCAGGACAGCCTGG - Intronic
986173794 5:5334700-5334722 GTGGCCCTGCCAGGACACCCAGG - Intergenic
989241582 5:39208719-39208741 GTGTGCTGGTTAGGAGACCCAGG + Intronic
990273882 5:54175024-54175046 GAGGGCTGGCCTGACTACCCTGG + Intronic
991674061 5:69075004-69075026 GGGGGCTGGGCACGGTACCCCGG - Intergenic
994118590 5:96088885-96088907 GTGGGGTTGCTGGGATACCCAGG + Intergenic
995455701 5:112349458-112349480 GTGGGAAGACCAGGATACCAGGG + Intronic
998205101 5:140152318-140152340 GTGGGCTGGCCAGAAATCACAGG + Intergenic
1000998370 5:167981480-167981502 GTGGGCTGGCTAGAATATTCTGG + Intronic
1003179830 6:3782070-3782092 GAGGGCTGGCAGGCATACCCTGG - Intergenic
1005355745 6:24981582-24981604 AAGGGCTGGCCAGGAGACCCTGG - Intronic
1006155912 6:32012671-32012693 GTGGGCTCGGCAGGACACCGGGG - Intergenic
1006162245 6:32045525-32045547 GTGGGCTCGGCAGGACACCGGGG - Exonic
1006171628 6:32096573-32096595 GTGTGCTGGCCGGGGTACACTGG - Intronic
1006171666 6:32096759-32096781 GTGTGCTGGCCCGGGTACACAGG - Intronic
1006938853 6:37738094-37738116 GTGGTCTGGACTTGATACCCTGG + Intergenic
1007275814 6:40672807-40672829 GTGGGCAGGCCAGGAAAGACAGG + Intergenic
1007355656 6:41313928-41313950 TTGGGCTGCTCAGGATCCCCAGG - Intergenic
1007390716 6:41548134-41548156 GGGGGCTGGCCAGGGAAGCCGGG - Intronic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1007843171 6:44733307-44733329 GAGGGCTGGGCAGGTTGCCCAGG + Intergenic
1008379932 6:50830008-50830030 TTGGGTTTGCTAGGATACCCAGG + Intronic
1009351923 6:62691129-62691151 TTGGGCCTGCCAGGAGACCCAGG - Intergenic
1013072435 6:106741230-106741252 GGGGCCTGGACAGAATACCCTGG - Intergenic
1013549849 6:111196615-111196637 GTGGTCTTGCCATGTTACCCAGG - Intronic
1013603467 6:111726595-111726617 ATGGACTGGCCAGGATTCCATGG - Intronic
1017224023 6:151999043-151999065 GAGGACTGGCCAGGAGAACCAGG - Intronic
1017648033 6:156556846-156556868 CTGGGCTGGGCTGGATACACAGG - Intergenic
1017768038 6:157623026-157623048 GAGGCATGGCCAGGATCCCCGGG + Intronic
1019160234 6:170064461-170064483 GTGGGCAGCCCAGGATCTCCTGG - Intergenic
1019320063 7:411379-411401 GCGGGCTGGAGAGGCTACCCCGG - Intergenic
1019499217 7:1355972-1355994 GGGCGCTGGCCAGGAGTCCCTGG - Intergenic
1019527996 7:1489423-1489445 TGGGGCTGGCCAGGCTCCCCTGG + Intronic
1019605773 7:1909548-1909570 GTAGGCTGGCCGGGACCCCCCGG + Intronic
1020213822 7:6173884-6173906 CAGGGCTGGCCATGTTACCCAGG + Intronic
1022680080 7:32536700-32536722 GTGGGGTGGCCTGGGGACCCAGG - Intronic
1023267614 7:38424094-38424116 TTGGGCTGGCCAGATTTCCCAGG - Intronic
1024292292 7:47813353-47813375 GTGGCCAGGCCTGGAGACCCCGG - Intronic
1024338802 7:48236672-48236694 CTGGGCTCACCAGGTTACCCAGG + Intronic
1024541813 7:50480812-50480834 GTGAGAAGGCCAGGATGCCCTGG + Intronic
1026292677 7:69022358-69022380 CTGGGCTGACCAGGACATCCAGG + Intergenic
1038865701 8:31436765-31436787 GAGGTCTGGCCAGGAGACCCTGG - Intergenic
1040841762 8:51792420-51792442 GTGGGCTCACGAGGATCCCCCGG - Intronic
1049101909 8:140586164-140586186 GTGGGCTGGGCACCATGCCCTGG + Intronic
1049308326 8:141919942-141919964 GTGAGCTGGGCAGGATGCCTGGG + Intergenic
1049399534 8:142418752-142418774 GCGGGCAGGGCAGGACACCCAGG - Intergenic
1049426722 8:142541099-142541121 GGGGGCAGGCCAGGCTTCCCAGG + Intronic
1050552690 9:6761509-6761531 GTGGTCTTGCCATGGTACCCCGG + Intronic
1052351762 9:27465660-27465682 GTGGACATGCCTGGATACCCAGG - Intronic
1053135294 9:35646987-35647009 CTGGGCGGGCCAGGAGAACCGGG + Intergenic
1054891787 9:70259299-70259321 GTGTGCTGGCCAGCAGGCCCCGG + Intronic
1056657637 9:88522394-88522416 ATGGGCTGGCCAGGATAAAGGGG - Intergenic
1059324189 9:113493694-113493716 GGGTGCTTGGCAGGATACCCTGG + Intronic
1059892279 9:118816546-118816568 GTGGGGTGGCCAGCCTTCCCAGG - Intergenic
1061178956 9:129012926-129012948 GTGGGCTGGCCATGGCACCGTGG + Intronic
1061838962 9:133346905-133346927 GAGGGCTGGCCAGGAGTTCCAGG - Intronic
1062315241 9:135963996-135964018 GTGGGCTGGTCGGGATCCCTAGG + Intergenic
1185890749 X:3819797-3819819 CTGGGCAGCCCAGGGTACCCGGG - Intronic
1187361647 X:18633654-18633676 GTGGGGTGGCTAGGAAACTCTGG + Intronic
1190114856 X:47619759-47619781 GTGGTCTGGCCAGGAGCCGCGGG + Exonic
1190828755 X:54042603-54042625 GAGGGCAGGCCAGGCTACACAGG - Intronic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198106021 X:133462088-133462110 GGGGGCTGGCCAGAACAGCCAGG + Intergenic
1198482379 X:137052682-137052704 GGGGGATGGTCAGGACACCCAGG - Intergenic