ID: 1080850387

View in Genome Browser
Species Human (GRCh38)
Location 11:36063429-36063451
Sequence AAGTGGATTAGTGGTTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4194
Summary {0: 1, 1: 14, 2: 225, 3: 933, 4: 3021}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080850387_1080850391 5 Left 1080850387 11:36063429-36063451 CCCTGGGAACCACTAATCCACTT 0: 1
1: 14
2: 225
3: 933
4: 3021
Right 1080850391 11:36063457-36063479 CTCTACAGATTTGCCTATTCTGG 0: 39
1: 236
2: 824
3: 1760
4: 2292
1080850387_1080850393 21 Left 1080850387 11:36063429-36063451 CCCTGGGAACCACTAATCCACTT 0: 1
1: 14
2: 225
3: 933
4: 3021
Right 1080850393 11:36063473-36063495 ATTCTGGACATTTCATATAATGG 0: 14
1: 40
2: 87
3: 139
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080850387 Original CRISPR AAGTGGATTAGTGGTTCCCA GGG (reversed) Intronic
Too many off-targets to display for this crispr