ID: 1080851610

View in Genome Browser
Species Human (GRCh38)
Location 11:36075041-36075063
Sequence ACTGTCTGCACAGCCAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080851610_1080851611 2 Left 1080851610 11:36075041-36075063 CCTAAACTGGCTGTGCAGACAGT 0: 1
1: 0
2: 2
3: 20
4: 177
Right 1080851611 11:36075066-36075088 AGTTGATGCTGTTTTTCTGCTGG 0: 1
1: 0
2: 3
3: 26
4: 334
1080851610_1080851612 10 Left 1080851610 11:36075041-36075063 CCTAAACTGGCTGTGCAGACAGT 0: 1
1: 0
2: 2
3: 20
4: 177
Right 1080851612 11:36075074-36075096 CTGTTTTTCTGCTGGAAGTCTGG 0: 1
1: 0
2: 3
3: 52
4: 372
1080851610_1080851613 18 Left 1080851610 11:36075041-36075063 CCTAAACTGGCTGTGCAGACAGT 0: 1
1: 0
2: 2
3: 20
4: 177
Right 1080851613 11:36075082-36075104 CTGCTGGAAGTCTGGAAATTTGG 0: 1
1: 1
2: 5
3: 91
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080851610 Original CRISPR ACTGTCTGCACAGCCAGTTT AGG (reversed) Intronic
900761042 1:4470661-4470683 AGTGCCTGCACTGCCAGCTTTGG + Intergenic
901637905 1:10678942-10678964 GCTGTCTGCAGAGCCAGCCTGGG + Intronic
903487927 1:23705344-23705366 GTTGTATGCACAGCCAGATTTGG + Intergenic
904287147 1:29460134-29460156 GCTGCCTGCACAGCCAGCTGTGG + Intergenic
904564722 1:31421840-31421862 ACTGTCTGCTCACCAAGCTTTGG + Intronic
906966556 1:50463055-50463077 ATTGTTTGCACAAACAGTTTAGG - Intronic
907740828 1:57163969-57163991 AATGCCTGCTCTGCCAGTTTGGG + Intronic
908842574 1:68294403-68294425 TTTGTCTGCAAACCCAGTTTCGG - Intergenic
911338677 1:96611392-96611414 AATGTCTGCTCAGGCAGTTCAGG - Intergenic
912206417 1:107514175-107514197 TCTGACTCCAAAGCCAGTTTTGG + Intergenic
919306772 1:195850272-195850294 ATTGTCTTCATAGCCATTTTTGG - Intergenic
920562806 1:206951010-206951032 ACTGTCTGCTAAGACAGTTTTGG + Intergenic
922194764 1:223350400-223350422 ACTGACTGCAAAGCCATGTTTGG + Intronic
922854043 1:228758798-228758820 ACTGTCTGCAGAGACAAGTTCGG - Intergenic
923114924 1:230926509-230926531 ACTGTTTGAACACACAGTTTAGG + Intronic
924127397 1:240869375-240869397 ACTGTCAGCAGAGACAATTTTGG + Intronic
1064192837 10:13222449-13222471 TCTGCCTGCCCAGCCAGTGTAGG + Intronic
1064584452 10:16825344-16825366 ATTATCAGCACAGCCAATTTTGG - Intronic
1066166724 10:32796561-32796583 ATTCTCTGCACAGAAAGTTTAGG - Intronic
1067070572 10:43128050-43128072 ACTGTCTGCACTTGAAGTTTTGG + Intronic
1067322277 10:45232387-45232409 ATTATCAGCACAGCCAATTTTGG - Intergenic
1067923929 10:50488271-50488293 ACTGTAATCCCAGCCAGTTTGGG - Intronic
1068867371 10:61908857-61908879 TCTGTCTACAAAGGCAGTTTGGG - Intronic
1069807056 10:71132640-71132662 TCTGTCTGCCCAGCCAGCTCTGG + Intergenic
1070739787 10:78895253-78895275 ACTTTCTGCACTGTCAGTTCAGG + Intergenic
1071688704 10:87792202-87792224 ATTGTTTGCACAAACAGTTTAGG - Intronic
1075421119 10:122301436-122301458 GCTGTCTGCACAGACAGTCCAGG + Intronic
1075492170 10:122880338-122880360 ACTTTTTACACAGCCTGTTTTGG - Intergenic
1075498768 10:122953660-122953682 ACTTTTTACACAGCCTGTTTTGG + Intronic
1076218446 10:128714320-128714342 AATGTCTGCAAAGGCAGTTGGGG + Intergenic
1079123234 11:17699709-17699731 ACTCACAGCACAGCCAGTGTGGG + Intergenic
1079429984 11:20380180-20380202 ATTGTTTGTACAGACAGTTTAGG + Intronic
1080851610 11:36075041-36075063 ACTGTCTGCACAGCCAGTTTAGG - Intronic
1080852388 11:36081014-36081036 ACTGTTTGCATAAACAGTTTAGG + Intronic
1082009682 11:47441729-47441751 GCTGTCTGCAGAGCCAGGTGGGG + Exonic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084077127 11:66788396-66788418 AATGTCTGCACAGGCAAGTTTGG - Intronic
1085216948 11:74841482-74841504 ACAATCTGCACATCCAGTCTTGG - Exonic
1085475845 11:76788442-76788464 AATGTCATCACAGCCAGTCTCGG + Intronic
1085532808 11:77201894-77201916 ACTGTCTGAACAGGCAGTGGGGG + Intronic
1085799512 11:79576096-79576118 TCTGGCTGCACAGCAAGTGTTGG - Intergenic
1086960923 11:92979667-92979689 ACTGTGTCCACAGCTAGGTTAGG - Intronic
1087139450 11:94751034-94751056 TCTGGCTCCAGAGCCAGTTTCGG + Intronic
1087195798 11:95303142-95303164 AGTGTCTGGAAAGGCAGTTTAGG + Intergenic
1088215084 11:107498677-107498699 ATTGTTTGCACAAGCAGTTTAGG + Intergenic
1089698498 11:120230057-120230079 ACTGTGTGCTCAGCCATTTGAGG + Exonic
1092554008 12:9536233-9536255 ACTCTCTGCACACCCGGATTTGG - Intergenic
1094518089 12:31154395-31154417 ACTCTCTGCACACCCGGATTTGG + Intergenic
1098407575 12:70142205-70142227 ACTGTTTGCAGACCCACTTTTGG - Intergenic
1100234003 12:92639238-92639260 ATTGTTTGCACAGACAGTTTAGG - Intergenic
1100719265 12:97340201-97340223 TCTGTCTGCCCAACGAGTTTTGG + Intergenic
1101549498 12:105748891-105748913 ACTGTCTAGACAGCCAGTTCAGG + Intergenic
1101697971 12:107144564-107144586 CCTTTCTGCAAAGCCAATTTTGG - Intergenic
1104873523 12:132017133-132017155 ACTGCCTGCAGGGCCAGTGTAGG + Intronic
1106052926 13:26208233-26208255 ATTGTTTGCACAAACAGTTTAGG - Intronic
1106719225 13:32421625-32421647 ACTGTCTGCCCGGCCCTTTTTGG - Intronic
1108429020 13:50335297-50335319 AGTGTCTGCACAGTCATTATGGG - Intronic
1108616743 13:52140652-52140674 ACTGTCAGCTGAGCCACTTTAGG - Intronic
1113695949 13:112345560-112345582 GCTGTCTCCCCAGCAAGTTTAGG + Intergenic
1119297295 14:73543243-73543265 AATGTCTGCATAGCCATCTTTGG - Exonic
1119301526 14:73575101-73575123 AATGTCTGCATAGCCATCTTTGG - Exonic
1121366587 14:93317771-93317793 ATTGTTTGCACAAACAGTTTAGG - Intronic
1121823838 14:96994137-96994159 AATGTCTACAGAGCAAGTTTAGG - Intergenic
1122758218 14:103999408-103999430 ACTCTCTGCAGAACCACTTTAGG - Intronic
1123424173 15:20155791-20155813 ACTGTCTGCAGATGCAGTTTTGG + Intergenic
1123533393 15:21162320-21162342 ACTGTCTGCAGATGCAGTTTTGG + Intergenic
1127464182 15:59227643-59227665 ACTGTATTCAAAGCCTGTTTGGG - Intronic
1129338644 15:74870241-74870263 ACAGTTTGCACAGTCATTTTTGG + Intronic
1129606341 15:77026884-77026906 ACTGGCTGCAAAGGCTGTTTTGG + Intronic
1131707299 15:95011722-95011744 TCTGTCTTCACAGCCAGTGGCGG - Intergenic
1133233967 16:4379170-4379192 ACTACCTGCACAGCCTGTGTGGG + Intronic
1136689739 16:32020577-32020599 ACTGTCTGCACATCCTCTCTGGG - Intergenic
1137604387 16:49777706-49777728 CCAGTCTGCACAGCTAGTTGGGG - Intronic
1138024216 16:53510238-53510260 ACGTTCTGCAGAGCGAGTTTAGG - Intergenic
1138642965 16:58400495-58400517 ATTGTTTGCACAGACAGTTCAGG + Intronic
1141924861 16:87161365-87161387 ACTGTCACCACAGTCAATTTTGG - Intronic
1203092531 16_KI270728v1_random:1225587-1225609 ACTGTCTGCACATCCTCTCTGGG - Intergenic
1142580099 17:936623-936645 ACTGTTTGCACAACCAGAATTGG - Intronic
1144274022 17:13647555-13647577 ACTGGCTGCACCTCCTGTTTAGG + Intergenic
1144418876 17:15077420-15077442 CCTGTCTGCACAGCCACAATGGG - Intergenic
1145252025 17:21301939-21301961 TCTGCCTGCACTGCCAGGTTCGG - Intronic
1145273095 17:21414965-21414987 AGTGCCTGCCCAGCCAGTTCGGG - Intronic
1145311288 17:21702409-21702431 AGTGCCTGCCCAGCCAGTTCGGG - Intronic
1146054385 17:29573918-29573940 ACTGTCCGGGTAGCCAGTTTTGG - Exonic
1146626521 17:34439347-34439369 TCTGACTGCACAGCCAGTGTTGG - Intergenic
1146840048 17:36145288-36145310 ACTGTTTGCACAAAAAGTTTAGG - Intergenic
1147152594 17:38526726-38526748 ACTGTCTGCACATCCTCTCTTGG - Intergenic
1153586316 18:6624283-6624305 ACTGTGGGCACAGCCACTTCAGG - Intergenic
1154199459 18:12289141-12289163 ACTGTCTGCACCTCCAGGCTAGG - Intergenic
1155098864 18:22588950-22588972 AAAATCTGCACAGCCACTTTGGG + Intergenic
1160501967 18:79406085-79406107 ACTGGCTGCTCAGCCAGTGACGG - Intronic
1160501968 18:79406090-79406112 ACTGGCTGAGCAGCCAGTTCAGG + Intronic
1161620605 19:5295028-5295050 ACTGTGTGCCCAGCCAAGTTGGG - Intronic
1168640466 19:58028285-58028307 ACTGTCCGCAGAGACAGTTTGGG + Intergenic
925309758 2:2874263-2874285 AAAGCCTGCAAAGCCAGTTTTGG - Intergenic
927647639 2:24888036-24888058 AATGTCAGCACAGCCAAATTTGG - Intronic
928045660 2:27928656-27928678 AATTGCTTCACAGCCAGTTTTGG + Intronic
928670502 2:33598989-33599011 ACTGTCTGCACTGCTAGCTCGGG - Intronic
929886540 2:45883772-45883794 CCTTTCTGCACAGCCACTGTGGG + Intronic
931659259 2:64543050-64543072 ATTCTCTCCACAGCCACTTTTGG - Intronic
934459076 2:94201248-94201270 ACTGTCTGCAGATGCAGTTTTGG - Intergenic
935304600 2:101724799-101724821 AGTGACTGCATAGCCAGGTTTGG + Intronic
937016543 2:118611149-118611171 ACAGCCTGCAGAGGCAGTTTTGG - Intergenic
937650634 2:124315275-124315297 TCTGTCTGGTCAGTCAGTTTTGG + Intronic
939093891 2:137810312-137810334 ATTGTGTGCACAGGCAGTTTAGG + Intergenic
939845246 2:147235896-147235918 ACATTCTGCACAGCCTCTTTGGG - Intergenic
940378082 2:152980278-152980300 AGTGTTTGCACATCCAATTTAGG + Intergenic
941721821 2:168820491-168820513 ACTGTCTGGACAGTCTCTTTAGG + Intronic
942495543 2:176536161-176536183 CCTGACTGCACAGCCAGTTTAGG - Intergenic
944614223 2:201443573-201443595 TCTGTCTGAAGAGCCAGATTGGG - Intronic
944723802 2:202449484-202449506 ACTGTTTGCACAAACACTTTAGG - Intronic
946324422 2:218977331-218977353 CCTGTCCACATAGCCAGTTTGGG - Intergenic
948880259 2:240853201-240853223 CTTGTCTGCACAGACAGCTTAGG + Intergenic
1170281731 20:14656549-14656571 CCTATATGCACTGCCAGTTTTGG - Intronic
1171077520 20:22143830-22143852 ACTGTCTGCACAGCCTCCCTGGG - Intergenic
1171348120 20:24481519-24481541 ACCGTCTCCACAGCCACTCTGGG + Intronic
1179145587 21:38764806-38764828 AATTTCTGCACAGCTAGTGTAGG + Intergenic
1179421440 21:41239756-41239778 ACTGTCTGCAGAGCCAGGGCTGG + Intronic
1179803718 21:43824372-43824394 CCTGTCTGCACAGCCACTCTAGG - Intergenic
1181357139 22:22305221-22305243 ACCGTCTGCAGATGCAGTTTTGG + Intergenic
1183037081 22:35148625-35148647 ACTGCCTGCACAGCCAGCCAAGG - Intergenic
1184020544 22:41818379-41818401 ATTGTTTGCACAAACAGTTTAGG + Intronic
950631270 3:14283666-14283688 GCTGTCAGCACAGCCAGGCTGGG - Intergenic
950826734 3:15831003-15831025 ACTGTCTGCACAACCCCATTAGG + Intronic
951041291 3:17991332-17991354 ACTGTCTACAAACCCATTTTTGG - Intronic
953291162 3:41664610-41664632 ACTGTCTGCTCAAACAGTTGAGG + Intronic
954586396 3:51740553-51740575 ACTGTCCGCACAGCCAATAGGGG + Intergenic
957410599 3:79834830-79834852 GCTGCCTATACAGCCAGTTTTGG + Intergenic
961513287 3:127417531-127417553 AGTGTCTACACAGGTAGTTTTGG + Intergenic
962441127 3:135417115-135417137 CCTGTATGCACAGGCAGCTTTGG + Intergenic
962532841 3:136299128-136299150 AATGTCTGCATAGCCCGCTTTGG + Intronic
962621460 3:137184291-137184313 GCTGTATGTACAGCCACTTTAGG - Intergenic
962878852 3:139557230-139557252 ACTGTTTGTACAAACAGTTTAGG + Intergenic
964650713 3:159008402-159008424 ATTGTCAGCACAGCCTGTTTTGG - Intronic
964799999 3:160545949-160545971 ACTGACTGATCAGCAAGTTTTGG + Intronic
966226970 3:177608357-177608379 ACTGTCTGCACATTCCCTTTTGG - Intergenic
966748680 3:183301941-183301963 ACTGTTTGCACAAACAGTTCAGG - Intronic
967237376 3:187399082-187399104 ACTGACTGCAGAGCCATTGTGGG - Intergenic
970166670 4:13245353-13245375 AGTTTCTGGACTGCCAGTTTAGG + Intergenic
975627338 4:76363090-76363112 ATTGTTTGCACAAACAGTTTAGG - Intronic
976015590 4:80549020-80549042 ACTGTATGCATAGTCAGTGTGGG + Intronic
981079590 4:140625492-140625514 TCTGTCTGACCAGCCAGCTTTGG - Intronic
981617841 4:146660802-146660824 ATTTTCTTCAAAGCCAGTTTTGG + Intergenic
983730638 4:170989540-170989562 AATGTCTGCACACCCAGCATTGG - Intergenic
987022532 5:13889573-13889595 ATTGTTTGCACAAGCAGTTTAGG - Intronic
989678497 5:44002217-44002239 ACTGTGTGCACTGGCAGTTAAGG + Intergenic
990833453 5:59986734-59986756 ATTATTTGCACAGACAGTTTAGG - Intronic
992447565 5:76847776-76847798 TCTGTCTGCATTGCCAGTTTTGG - Intergenic
992844901 5:80736614-80736636 ACTGTGTGCACAAACAGTTAAGG - Intronic
993504308 5:88692336-88692358 ACTGTGAGCACAGCCCGCTTGGG + Intergenic
995186633 5:109279206-109279228 ACTGTGTCCACAGCCAGCCTAGG + Intergenic
996234692 5:121110843-121110865 ACTGTTTGCCCAGACTGTTTTGG + Intergenic
996942956 5:129031870-129031892 ACTGTCATCACAGCCAGATATGG - Intronic
998112491 5:139512954-139512976 ACTGCCTGCAGGGCCAGGTTTGG + Intergenic
999176086 5:149632605-149632627 ACTGTCTGACCAGGCAGTTCTGG - Exonic
1002153757 5:177258447-177258469 CCTATATGCACAGACAGTTTTGG - Intronic
1004189375 6:13450764-13450786 ACTGTTTGCACAAGCAGCTTCGG + Intronic
1006812211 6:36827278-36827300 TCTGTCTGGACAGGCAGTTAGGG - Intronic
1007085546 6:39141894-39141916 ATTATCTGCAGAGCCAGTTCTGG + Intergenic
1014134885 6:117877382-117877404 ACTGTCTGCACTCCCATTTCTGG + Intergenic
1016571860 6:145522276-145522298 TCTGTCTACACATCCAGCTTAGG + Intronic
1017750026 6:157482620-157482642 ACTGTCTTCACAGCCTGTCCAGG + Intronic
1021869597 7:24991422-24991444 ACAGTTTGCACAGACAGTTCAGG + Intergenic
1021870769 7:25004063-25004085 ACTGTTTGCACAGACACTTCAGG + Intergenic
1022119605 7:27295123-27295145 AGTGTCTGAACACACAGTTTGGG - Intergenic
1026367579 7:69664701-69664723 ACTGTCTGAACAGGGGGTTTGGG - Intronic
1029452641 7:100649801-100649823 ACTGTCTGCTCAGCCTGATCCGG + Intronic
1034137439 7:148783786-148783808 ACTGTCTGTACATACATTTTGGG - Exonic
1035287624 7:157816344-157816366 AAGGTCTCCACAGCCAGTTTAGG - Intronic
1036160181 8:6380387-6380409 ACTGTCTCCCCAGATAGTTTTGG + Intergenic
1038479286 8:27890719-27890741 ACTGTGTGCACAGCGAGCTGTGG - Intronic
1043991596 8:86762453-86762475 ACTGTTTGCACAAACAGTTTAGG + Intergenic
1046801815 8:118437036-118437058 ACTGTCTGCACACCCTGGTGAGG + Intronic
1050516496 9:6449700-6449722 ACTGTTTGCAAAAACAGTTTAGG - Intronic
1053526470 9:38835292-38835314 TCTGGCTGCACCTCCAGTTTGGG - Intergenic
1053689568 9:40577037-40577059 ACTGTCTGCAGATGCAGTTTTGG - Intergenic
1054198696 9:62059717-62059739 TCTGGCTGCACCTCCAGTTTGGG - Intergenic
1054274462 9:63054020-63054042 ACTGTCTGCAGATGCAGTTTTGG + Intergenic
1054300814 9:63377976-63377998 ACTGTCTGCAGATGCAGTTTTGG - Intergenic
1054400362 9:64710909-64710931 ACTGTCTGCAGATGCAGTTTTGG - Intergenic
1054433953 9:65195167-65195189 ACTGTCTGCAGATGCAGTTTTGG - Intergenic
1054496434 9:65826503-65826525 ACTGTCTGCAGATGCAGTTTTGG + Intergenic
1054639659 9:67528648-67528670 TCTGGCTGCACCTCCAGTTTGGG + Intergenic
1057861750 9:98646194-98646216 ATTGTCTGCACAAACAATTTAGG - Intronic
1058056775 9:100456883-100456905 CCTTACAGCACAGCCAGTTTTGG + Intronic
1059169704 9:112113579-112113601 CCTGTCTGCACAACCACTTGCGG - Intronic
1059442296 9:114315258-114315280 ACTGTGGGTACTGCCAGTTTAGG - Intergenic
1060946138 9:127569988-127570010 ACTGTCTCCCCTGCCAGCTTGGG - Intronic
1062599816 9:137314704-137314726 AATGTCTCCACAGACAGTGTGGG + Intronic
1186541984 X:10410180-10410202 ATTGTCTGTACAGACACTTTAGG - Intergenic
1187278380 X:17836685-17836707 ACTGTCTGCATCGCCTGGTTTGG - Intronic
1188408508 X:29842126-29842148 ACTGTCTGCACAAACAGTTTAGG + Intronic
1190098824 X:47504589-47504611 ACTGTTTGCACAAACAGGTTGGG - Intergenic
1190582671 X:51903743-51903765 GCTGTGTCCACAGCCAGCTTGGG + Intergenic
1190929159 X:54933778-54933800 GCTGTGTCCACAGCCAGCTTGGG + Intronic
1192235040 X:69290184-69290206 ACTGTTTGGCCAGTCAGTTTAGG + Intergenic
1194983329 X:100462508-100462530 ATTGTCTCAACAGCTAGTTTTGG - Intergenic
1196618173 X:117791886-117791908 ACCATCTGCACAGCCACCTTTGG + Intergenic
1198092496 X:133345522-133345544 TCTGTTTACACACCCAGTTTAGG - Intronic
1198786894 X:140298502-140298524 AGTGTCTCCACCTCCAGTTTAGG + Intergenic