ID: 1080851727

View in Genome Browser
Species Human (GRCh38)
Location 11:36076311-36076333
Sequence CAATTCCTTCAAATTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080851724_1080851727 1 Left 1080851724 11:36076287-36076309 CCTTGAGTTCATACTGGTGACCT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1080851727 11:36076311-36076333 CAATTCCTTCAAATTTCCATTGG 0: 1
1: 0
2: 2
3: 29
4: 276
1080851722_1080851727 24 Left 1080851722 11:36076264-36076286 CCTGTCTGTCTAATTTTTAAAGA 0: 1
1: 0
2: 4
3: 83
4: 724
Right 1080851727 11:36076311-36076333 CAATTCCTTCAAATTTCCATTGG 0: 1
1: 0
2: 2
3: 29
4: 276
1080851721_1080851727 28 Left 1080851721 11:36076260-36076282 CCATCCTGTCTGTCTAATTTTTA 0: 1
1: 1
2: 45
3: 890
4: 10438
Right 1080851727 11:36076311-36076333 CAATTCCTTCAAATTTCCATTGG 0: 1
1: 0
2: 2
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080851727 Original CRISPR CAATTCCTTCAAATTTCCAT TGG Intronic
900489671 1:2941397-2941419 CAACTCCTTCAAAATGCCAAGGG - Intergenic
900627388 1:3615137-3615159 CAGTCCCTTCAAAGTTGCATTGG + Intergenic
904002997 1:27349330-27349352 CAGTTCCTACAAATTTGCTTAGG + Intronic
904072885 1:27815783-27815805 AATTGCCCTCAAATTTCCATAGG + Intronic
904988895 1:34575701-34575723 AAATTTTTTAAAATTTCCATAGG - Intergenic
905002207 1:34681479-34681501 GAATTGCTTCACATTTCCTTAGG - Intergenic
905931960 1:41794509-41794531 AAATTGCTTCAAATATCCAAAGG - Intronic
906488495 1:46249195-46249217 CCCTTCCTTCAAAGTTCCAGTGG - Intronic
908048411 1:60198897-60198919 CAATTCTGTTAAATTTCCCTAGG + Intergenic
908520950 1:64941525-64941547 CAATTATTTCAAATTTCCCATGG + Intronic
908606437 1:65802221-65802243 CAATTCCTTCATAGTTTCCTCGG - Intronic
908647337 1:66292873-66292895 AAATTCATTCAAACTTCCTTAGG - Intronic
908661339 1:66438641-66438663 AAATTCCTTCAAATTTATTTCGG + Intergenic
911226844 1:95316326-95316348 CAAATTCCTCAAATTACCATTGG - Intergenic
912652203 1:111449406-111449428 CTCTTCCTTCAACTTTCCTTGGG - Exonic
913550381 1:119911755-119911777 CAACTACTTCGCATTTCCATTGG + Exonic
913973577 1:143435782-143435804 CATTTACTTCTCATTTCCATAGG - Intergenic
914067965 1:144261389-144261411 CATTTACTTCTCATTTCCATAGG - Intergenic
914111190 1:144704965-144704987 CATTTACTTCTCATTTCCATAGG + Intergenic
916334347 1:163653473-163653495 CAATAGCTTAAAATTTCAATTGG + Intergenic
916366268 1:164031611-164031633 TCATTCCTTCACATTTCCCTTGG + Intergenic
917053429 1:170951043-170951065 AAATTCCTTCAAATCCACATAGG - Intronic
917781432 1:178401471-178401493 CAACTCTTTAAAAGTTCCATGGG + Intronic
919831618 1:201544835-201544857 CACTTCCTTCAGATTTTCACTGG + Intergenic
920896338 1:210054015-210054037 CAATGACTTCAAAATTCTATAGG - Intronic
921617480 1:217287003-217287025 GCATTCCTTAAAAGTTCCATTGG - Intergenic
922709912 1:227819514-227819536 CAATTCCTATAAAATTCCAATGG - Intronic
923012752 1:230101816-230101838 CAATTGCTCCAAATTACCAGAGG - Intronic
923282804 1:232461071-232461093 CAATTCCTTCAAAATTCACATGG + Exonic
924645242 1:245871692-245871714 CAAGTCCTTCAACCTTCCAGAGG + Intronic
1063691237 10:8289428-8289450 CAATTCCTTGAAAATTCCAATGG + Intergenic
1063770636 10:9194907-9194929 CATTTCCTTCACATTTTTATTGG + Intergenic
1064649418 10:17493304-17493326 ATATTCCTTCAAAATTCCAATGG - Intergenic
1065729436 10:28697306-28697328 GAATTCCTTCCCAGTTCCATAGG - Intergenic
1066658333 10:37715180-37715202 CAATTCTTCCAAAATTCTATAGG - Intergenic
1068342393 10:55723335-55723357 CAATTCCTTCAAATGTTCTTTGG - Intergenic
1068766565 10:60770689-60770711 TAATTTTTTAAAATTTCCATAGG - Intergenic
1069128997 10:64675505-64675527 TATTTGCTTTAAATTTCCATAGG + Intergenic
1069152059 10:64975152-64975174 TAATTCCTTAAAATTTTCTTAGG - Intergenic
1069314738 10:67083133-67083155 GAATCCCTTTAAATATCCATAGG + Intronic
1070613637 10:77951963-77951985 CAATGCTTTCAAACTTCCAAAGG - Intergenic
1071319605 10:84440843-84440865 CAATGCCCTCAAATTTCTAAGGG - Intronic
1072828385 10:98631659-98631681 CCATTCCTCCAAATGTCCATGGG + Intronic
1073731315 10:106291528-106291550 TAATTACTACAAATTCCCATGGG - Intergenic
1073740132 10:106397294-106397316 CATTTCATCCAAATTTCCTTAGG - Intergenic
1073985280 10:109201346-109201368 CAATTCTTTCAACTCTGCATAGG + Intergenic
1074458629 10:113616736-113616758 CAAACCATTCAACTTTCCATGGG - Intronic
1077427488 11:2490185-2490207 GAATTCCTTCTCCTTTCCATAGG - Intronic
1079509324 11:21192684-21192706 CTACTTCTTAAAATTTCCATAGG - Intronic
1080851727 11:36076311-36076333 CAATTCCTTCAAATTTCCATTGG + Intronic
1081346982 11:42000107-42000129 CATTTCCTTCAAAATCCCATTGG - Intergenic
1082948376 11:58785326-58785348 CACTTGTTTAAAATTTCCATTGG + Intergenic
1085328902 11:75630640-75630662 AGATTCCTTCAAATTTCTCTGGG + Intronic
1085332614 11:75666886-75666908 CAATGACTTCAAAGTTCCAGCGG + Intronic
1085499933 11:77010820-77010842 CAATGCCTTCAAATTTCTAAAGG + Intronic
1085829769 11:79886899-79886921 CATTTCCTTCAAATTAACACTGG - Intergenic
1086771478 11:90773219-90773241 CAGTTCCTTCAAAGTGTCATTGG + Intergenic
1087113792 11:94501200-94501222 AAATTCCTGGAAATTTCCCTTGG + Intergenic
1087557529 11:99740551-99740573 TAATTCATTCAAATCTCCCTAGG - Intronic
1089464364 11:118675081-118675103 CAATCACCTCTAATTTCCATTGG + Intronic
1092640086 12:10496522-10496544 CTATTCCTTTAAAATTCCAAAGG + Intergenic
1092692217 12:11126524-11126546 CAAGTCTGTCAAATGTCCATGGG - Intronic
1093040263 12:14370553-14370575 CAATTCCATTAAATTTACATTGG + Intronic
1093596239 12:20963586-20963608 CAAAGCCTTTAAATCTCCATAGG + Intergenic
1094248731 12:28334294-28334316 CCATTCCTTCAAATTGCCCGAGG - Intronic
1094288100 12:28816938-28816960 CTATTGCTTCAGATTACCATAGG - Intergenic
1096305250 12:50469166-50469188 TAATACCTTCAAAGTTCCAAGGG - Intronic
1096343577 12:50824940-50824962 CAATACTTTCAACTTACCATGGG - Intergenic
1096554128 12:52393016-52393038 CCATTCCTTCACATTCTCATTGG - Intergenic
1096648514 12:53050613-53050635 CATTTCCCTCAAACTTCCCTGGG - Intronic
1097533998 12:60841901-60841923 CAAATACTTTAATTTTCCATAGG - Intergenic
1098403758 12:70102327-70102349 CAGTTTCTTTAAATTTCCTTTGG + Intergenic
1098502132 12:71205605-71205627 AAATTCCTTTAAATTTCATTTGG + Intronic
1100356437 12:93835257-93835279 CAATTCCTCCAAAATTCTAAGGG - Intronic
1102195536 12:111022676-111022698 CACTTCCTTCCAATCTCCAGGGG - Intergenic
1103111868 12:118287207-118287229 TAATTTTTTAAAATTTCCATAGG - Intronic
1103476436 12:121222250-121222272 CAATTCCTTCACATGACCCTGGG + Intronic
1106791173 13:33156070-33156092 CATTACCATAAAATTTCCATGGG + Intronic
1107127952 13:36864762-36864784 CTTTTCTTTCAAATTTCCAGGGG - Intronic
1107504456 13:41018638-41018660 CAATTCATTTAAATTTCCATTGG + Intronic
1107745852 13:43507492-43507514 CAATGCCTTCAAATTTCCAAGGG + Intronic
1108227675 13:48305451-48305473 CAATTCTTGCAAATTTCCCTTGG + Intronic
1109234053 13:59793662-59793684 CCATTCCTTGAATTTTCCATTGG + Intronic
1109577990 13:64287389-64287411 CAATTTTTTCTAATTTCAATGGG + Intergenic
1110159205 13:72354988-72355010 CTTTTCTTTCAAATTTCCAGGGG + Intergenic
1111882684 13:93977790-93977812 CAATTCCCTGAAATTGCAATAGG + Intronic
1112071495 13:95855969-95855991 CAATACCTTCAATTTTCCCCTGG + Intronic
1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG + Intergenic
1113308120 13:109100488-109100510 CATTCCTTTCAAATTTCCTTTGG + Intronic
1113538820 13:111090500-111090522 CAATTAGTTCATATGTCCATGGG - Intergenic
1114926396 14:27405210-27405232 AAGTTCCCCCAAATTTCCATAGG - Intergenic
1117178970 14:53173250-53173272 GAATTACTTCAAATTTTCTTGGG + Intergenic
1117943786 14:60996836-60996858 CAATGCCTTCAAAATTCCTGGGG + Intronic
1120533207 14:85659130-85659152 CATTCCCTTCAAATTTCAGTTGG + Intergenic
1120712718 14:87809514-87809536 CAATTCCCTCCAATTCCCCTTGG - Intergenic
1120743633 14:88134313-88134335 CCATCCCTTCAACTTTCAATAGG - Intergenic
1125033875 15:35101223-35101245 CATTTGCTTCAAGTTTCCTTTGG + Intergenic
1125761837 15:42101850-42101872 TAATTTCTTCAAATTTCCTATGG - Intergenic
1127024505 15:54788679-54788701 CAATGGCTTCCAATTGCCATGGG - Intergenic
1127304320 15:57690292-57690314 CAATGAATTCAAATTTCCATAGG - Intronic
1129545165 15:76388159-76388181 CAATTCCTTCAAATATTCCTTGG - Intronic
1131309826 15:91279880-91279902 TAAATTCTTCAGATTTCCATGGG - Intronic
1131660411 15:94508891-94508913 CCTTTCCTTCAAATTTTAATTGG - Intergenic
1135830343 16:25767440-25767462 CAACTCCATCCAGTTTCCATGGG + Intronic
1137507995 16:49072967-49072989 TAATAACTTCAATTTTCCATAGG - Intergenic
1139023715 16:62785988-62786010 CAATTTCTTCAAATGTATATGGG + Intergenic
1143090993 17:4449106-4449128 CATTACCTTCAAGATTCCATAGG - Intronic
1145847699 17:28056750-28056772 CAATTCTTTCAAATTTCCTGAGG - Intronic
1145847706 17:28056853-28056875 CAATTCTTTCAAATTTCCTGAGG - Intronic
1145850240 17:28086307-28086329 CAATTCCTTTTATGTTCCATGGG + Intronic
1146935600 17:36810818-36810840 CACTCCCTTCTCATTTCCATAGG + Intergenic
1148675151 17:49440615-49440637 CCTTTCCTTCCAATTTCCATGGG + Intronic
1149409216 17:56387169-56387191 CAATTCCTGCTACTTTCTATGGG + Intronic
1150892897 17:69174924-69174946 CAATAACTACACATTTCCATTGG - Intronic
1154012388 18:10586753-10586775 CAATGCCTTCGAATTTCCAAAGG - Intergenic
1155097581 18:22573456-22573478 CAATTCTTTAGAATTTTCATTGG + Intergenic
1155702064 18:28758235-28758257 CAATTCTTTCAGATTTAAATAGG - Intergenic
1156890047 18:42180236-42180258 AAATTACTTCAAAATTGCATGGG + Intergenic
1157150474 18:45212414-45212436 AAAGTCCATCAAATTTCCTTTGG + Intergenic
1159372087 18:67541420-67541442 AAATTTTTTAAAATTTCCATAGG + Intergenic
1159495974 18:69205317-69205339 CAATTCCTTCCTATTTCTACTGG + Intergenic
1159588695 18:70307655-70307677 ATAGTCCTTTAAATTTCCATAGG + Intronic
1159643998 18:70895927-70895949 AAATTCCTCCAAATTCCCATAGG - Intergenic
1159991402 18:74913175-74913197 GAATTGCTTCAAATGTCAATGGG - Intronic
1165610545 19:37148138-37148160 CAATGCATGAAAATTTCCATTGG + Exonic
926236497 2:11049219-11049241 CTCTTCCTTCAAGTTTCCCTTGG + Intergenic
926393106 2:12414153-12414175 TAAGTACTTCAAACTTCCATGGG - Intergenic
927166328 2:20326163-20326185 CAATTTCTTCAATTTTTCTTAGG + Intronic
928307079 2:30179067-30179089 CTAGTCCTTCTAATTTCCAGCGG - Intergenic
928616793 2:33048344-33048366 AAAATCCTTCAAATTTCTCTTGG + Intronic
928871206 2:35982528-35982550 CAATGCTTTCAAAATTCTATGGG + Intergenic
929771811 2:44898627-44898649 CCATCTCTTCAATTTTCCATAGG - Intergenic
929773729 2:44914702-44914724 AAATTACTTCAACTTTCCATAGG - Intergenic
929948677 2:46389627-46389649 CAACTCCTGCAAATGTCCAGAGG + Intergenic
929969105 2:46558447-46558469 CAATGCCTTAAAAATTCCAAAGG - Intronic
930000067 2:46855405-46855427 CATTGCCTTGAAATTTCCAGTGG + Intronic
931035013 2:58230716-58230738 TAGTTCATTCAAATGTCCATTGG + Intronic
931842776 2:66171758-66171780 CAATCCTTTCAAATCTCCCTTGG - Intergenic
933469426 2:82702382-82702404 GAAGTCCCTCACATTTCCATGGG - Intergenic
933479065 2:82831923-82831945 CAATTATTTCAAATATCCAGAGG - Intergenic
934178271 2:89596748-89596770 CATTTACTTCTCATTTCCATAGG - Intergenic
934288566 2:91671040-91671062 CATTTACTTCTCATTTCCATAGG - Intergenic
935408352 2:102733575-102733597 CCATTACTTAAAATTTCCTTTGG + Intronic
936124643 2:109777598-109777620 CAATGCTTTCATGTTTCCATGGG - Intergenic
936220046 2:110593868-110593890 CAATGCTTTCATGTTTCCATGGG + Intergenic
936931639 2:117795980-117796002 CAATTCTAAGAAATTTCCATAGG - Intergenic
937861184 2:126711688-126711710 CACTTGTTTAAAATTTCCATTGG - Intergenic
938259781 2:129887422-129887444 AAATTCCTTCAAAATCCAATTGG - Intergenic
940732264 2:157406171-157406193 CATTTCTTTTAAATTTCCAAAGG + Intergenic
940791077 2:158030981-158031003 CAGTTCCCTCAACTTTCCAAGGG + Intronic
946447984 2:219755858-219755880 TAATTGATTCAAAATTCCATAGG - Intergenic
946792760 2:223318200-223318222 CAATTCCTTCAAAATGCAAGAGG - Intergenic
946855056 2:223943661-223943683 CATTTCCTTCAAATTCCCACCGG + Intronic
947977230 2:234377500-234377522 CACATTTTTCAAATTTCCATTGG + Intergenic
1169134506 20:3189131-3189153 CAAGTAATTCAAATCTCCATTGG - Intergenic
1169594123 20:7178571-7178593 CATTTACTTCAAATACCCATTGG + Intergenic
1170352609 20:15458719-15458741 TAGTTCTTTCAAAGTTCCATGGG + Intronic
1172398913 20:34632235-34632257 CAATGCCTTCAAAATTCTAAAGG + Intronic
1174883128 20:54302790-54302812 AAATTCCTTCAAATTAGCTTAGG + Intergenic
1175746928 20:61463587-61463609 CAATGGCTTCAAATGTGCATAGG + Intronic
1178004922 21:28207654-28207676 CAATTCCCTCAAAAGTCCCTAGG + Intergenic
1178765257 21:35444662-35444684 AAATTCTGGCAAATTTCCATGGG - Intronic
1179378332 21:40873686-40873708 CAATTCTTTTAAATTTCTTTGGG - Intergenic
1181004142 22:20001842-20001864 GATTTCCTTTAAATCTCCATGGG - Intronic
1184952714 22:47855779-47855801 TAATGCCTTCAAATTTCTAGAGG + Intergenic
1184972316 22:48033673-48033695 CATTTCCTTTTAATGTCCATAGG + Intergenic
1184985713 22:48132062-48132084 AAAAACCTTCAAATTTCCACGGG + Intergenic
1185160082 22:49219236-49219258 CAGTTCCTGCTAATTTACATGGG - Intergenic
949690814 3:6636764-6636786 TAATTCCAACTAATTTCCATAGG + Intergenic
955558824 3:60166556-60166578 GAATTCCTTCATCTTTCCACTGG - Intronic
956821169 3:72955643-72955665 AAATTTCTTCAAATTACCCTAGG + Intronic
956928909 3:74020458-74020480 AAATTACTTCATATTTTCATTGG - Intergenic
957416107 3:79907585-79907607 CAATTTCTTCAGATTCCTATGGG + Intergenic
958724743 3:97890908-97890930 CATTTACTTCAAATTTGGATTGG - Intronic
959371973 3:105538178-105538200 CAATGCCATCAAATTTCACTTGG - Intronic
962441552 3:135423054-135423076 CAGTTCCCTCAAATGACCATTGG - Intergenic
964914326 3:161821264-161821286 TAATTCCTTGAAATTGCCATTGG + Intergenic
965159083 3:165107695-165107717 GACTTCCTTTAATTTTCCATAGG + Intergenic
966376956 3:179306147-179306169 CAATATCTTCAAATTTCCAAGGG - Intergenic
967909125 3:194526621-194526643 CAGTTCCTTAGAAATTCCATGGG + Intergenic
969830975 4:9796647-9796669 CATTTACTTCTCATTTCCATAGG + Intronic
970640535 4:18060604-18060626 CAATATCTTCAAAGTTCCAAAGG - Intergenic
973310719 4:48706803-48706825 CAATTCCTTGACCCTTCCATAGG - Intronic
973598827 4:52520847-52520869 CAAATCCTTCGATTTCCCATAGG - Intergenic
973864917 4:55102852-55102874 GAATCCCTTCAAATTTCTCTTGG + Intronic
975227730 4:71893443-71893465 CAATTTCTTCATAGTGCCATTGG - Intergenic
976439078 4:85053453-85053475 GAATGCCTTCAAAGTTCCAAAGG - Intergenic
977301401 4:95271764-95271786 CAATTCCTTAATGTCTCCATTGG + Intronic
978309031 4:107365103-107365125 CAATTTTTTCAATTGTCCATTGG - Intergenic
982035880 4:151345277-151345299 CAATGCCTCCAAATTTCTAAAGG - Intergenic
984044104 4:174776117-174776139 CATTTCCTCAAAAATTCCATAGG - Intronic
984059630 4:174976044-174976066 CAATTTCTTCAAATTCCATTCGG - Exonic
985162798 4:187061865-187061887 CACTTCCTTCAGTTCTCCATGGG + Intergenic
985989688 5:3545429-3545451 CAAGTCATTCACATTTCCAAAGG + Intergenic
988477530 5:31600442-31600464 ATATACCTTCAAATTTCCAAGGG - Intergenic
988957437 5:36333301-36333323 CAATTTATTCAAATTTCCTAGGG - Intergenic
989132107 5:38117404-38117426 TAATTCCTTCAAAATTTGATAGG + Intergenic
989187064 5:38635962-38635984 CACACCCCTCAAATTTCCATAGG - Intergenic
989249184 5:39288756-39288778 CAATTCCCTCAAATTTGAATGGG + Exonic
989331800 5:40268565-40268587 CAATTCTTTTAAATTTCTCTGGG - Intergenic
989704444 5:44311734-44311756 CAATACATACAAATTCCCATTGG + Intronic
990511519 5:56493408-56493430 CCATTACTTCAAATTTCCAGAGG - Intergenic
991482758 5:67100856-67100878 CACTGCCTTGAAATTTCCAGTGG - Intronic
991616979 5:68507164-68507186 CCATTCCTTCAAAATGCCTTGGG - Intergenic
992289129 5:75266840-75266862 CATTTCCTTGCAATTTTCATGGG + Intergenic
993854827 5:93061291-93061313 TACTTCCTACAAATTTCTATTGG + Intergenic
994815848 5:104587349-104587371 CAATTCCTTCATAATTCTCTTGG + Intergenic
995694671 5:114865889-114865911 AAATTGCTACAAATTTCAATTGG + Intergenic
995813715 5:116141451-116141473 CAATTCCATCAAAATTCCAATGG - Intronic
996091340 5:119355204-119355226 GAATTCCTTCAAAATGCCAAAGG - Intronic
997084390 5:130780552-130780574 CATTTTTTTAAAATTTCCATAGG - Intergenic
997221642 5:132171780-132171802 CATTTCCTTGTAATTTCTATAGG - Intergenic
997435619 5:133872545-133872567 CAATGCCTTCAAATTTCTGAGGG + Intergenic
998540307 5:142975046-142975068 CAATCGTTTCAAATCTCCATTGG + Intronic
998928516 5:147155073-147155095 CTATTCCTTCCAGTTTCCAGAGG - Intergenic
1000388470 5:160698726-160698748 CCATTCTTTCAATTTCCCATTGG - Intronic
1000736924 5:164915025-164915047 AAATTCCTTATAATTTACATTGG - Intergenic
1002876993 6:1219505-1219527 AAATGCCTTCCAATTCCCATTGG + Intergenic
1003205972 6:4011997-4012019 CAATTCCAGCAAGTTCCCATGGG - Intergenic
1003221399 6:4164082-4164104 AAATCCCTTCTAATTTCCAAGGG + Intergenic
1003984159 6:11418913-11418935 AAATTCCTTTAAAATTCCTTGGG + Intergenic
1005409576 6:25529221-25529243 TTATTCCTTCACACTTCCATGGG + Intronic
1008442497 6:51548325-51548347 CAATTTCTTCAATCTTCCACTGG - Intergenic
1008654230 6:53595176-53595198 CAATTTCTTCACATATTCATTGG + Intronic
1010320253 6:74498999-74499021 AAATTCCTTCAAACTTTTATGGG - Intergenic
1010623313 6:78103667-78103689 CAATTCTATCAAATTCACATAGG - Intergenic
1011713690 6:90081818-90081840 CAATTCCTTAAATTTTACCTTGG + Intronic
1012292336 6:97472288-97472310 CAATTCCTGAAATTTTCCAAAGG - Intergenic
1013468710 6:110441358-110441380 CACTTGTTTAAAATTTCCATGGG - Intronic
1014044599 6:116871088-116871110 CATTTCCTTCGATTTTCCTTAGG - Intergenic
1014045459 6:116879838-116879860 GAATTACTTCAAATTTTCAAAGG + Intronic
1015051573 6:128847273-128847295 CAATTCCTTATAATATTCATAGG - Intergenic
1016619771 6:146094900-146094922 CAATTCCTCCAAAGATCCAAAGG + Intronic
1017388846 6:153916112-153916134 CATTTCCTACATATTTCAATGGG - Intergenic
1017417998 6:154242375-154242397 CCATTTCTTGAAATTCCCATGGG + Intronic
1018281747 6:162193646-162193668 CAACTCCTACAAATGGCCATAGG - Intronic
1018620812 6:165727630-165727652 TACTCCCTGCAAATTTCCATAGG - Intronic
1019916492 7:4136305-4136327 CAATTCCTGCAAATTCAGATGGG + Intronic
1020725286 7:11805234-11805256 CATTTCCTTCAACTCTCCTTTGG - Intronic
1022436400 7:30389988-30390010 CAATTCCTCCAAGTATCCACAGG + Intronic
1022836480 7:34121440-34121462 GAATTCCTTCAATTTTTCCTAGG + Intronic
1026590189 7:71687635-71687657 CAATTCCTAGAAATCACCATGGG + Intronic
1027475256 7:78622279-78622301 CAATTCCTTCTTATTTTCTTTGG + Intronic
1028073347 7:86479513-86479535 CAATTCATTTAAATTTTCTTAGG - Intergenic
1028084629 7:86620980-86621002 CAATTCCTTTAAAGGTCTATGGG + Intergenic
1028860058 7:95639033-95639055 CACTTCCTTCATATTTCCTGGGG + Intergenic
1030900541 7:115118014-115118036 CAATTCCTACAACTCTTCATTGG - Intergenic
1031587519 7:123550596-123550618 CAAACCATACAAATTTCCATAGG + Intronic
1033943945 7:146691145-146691167 CATTTTCTTAATATTTCCATTGG + Intronic
1033956347 7:146853457-146853479 AAATTCCATTAAATATCCATAGG - Intronic
1034134665 7:148755331-148755353 GAGTTCCTGCAAATTTCCCTGGG - Intronic
1036218189 8:6898075-6898097 CAATGCTTTCAAATTTTCACAGG + Intergenic
1036426920 8:8653572-8653594 CAATGCCTTCAAATTTCTAAGGG + Intergenic
1037019653 8:13954085-13954107 GACTGCCTTCAAATTTCCAAAGG - Intergenic
1037045639 8:14299444-14299466 CAATTCCTACAAATTACAGTAGG + Intronic
1037542165 8:19882591-19882613 CAATTTAGACAAATTTCCATTGG + Intergenic
1038131868 8:24741269-24741291 CAATTCCTAGATATGTCCATGGG + Intergenic
1038608130 8:29031368-29031390 TATTTTCTTCAAATTTACATAGG - Intronic
1039107996 8:34010053-34010075 GAATTCCTTAAAATGTCCAAGGG - Intergenic
1041304116 8:56442183-56442205 AAATTCTTTAAAATTTCTATGGG - Intronic
1041945647 8:63438754-63438776 CAATGTCTTCAAAGTTCCAAGGG - Intergenic
1042009210 8:64221109-64221131 CAATTCCTTCAAAATCCCACAGG - Intergenic
1042579856 8:70264554-70264576 CAATTTATTCCAATTTACATTGG - Intronic
1043938314 8:86168212-86168234 CTATTCCTTGAAATTTCTATAGG + Intergenic
1044278682 8:90331894-90331916 CAATTCCTTTTAAGTTCCAAAGG + Intergenic
1045703221 8:104891169-104891191 CAAATACTTCAAATCTCCATTGG - Intronic
1046775184 8:118156951-118156973 CCAACCCTTCTAATTTCCATAGG - Intergenic
1047564839 8:126032602-126032624 AAATTCCTTCAGATTTAAATGGG - Intergenic
1047675993 8:127202552-127202574 CAATGGCTTCCAATTTCCAGCGG - Intergenic
1047974942 8:130120797-130120819 CAATGCCTTCAACTTTTTATGGG + Intronic
1048511626 8:135067735-135067757 CAATTACTTCAAAATTCTAAGGG - Intergenic
1050963528 9:11767641-11767663 CAATTTCTTCATAGTGCCATTGG - Intergenic
1051130877 9:13859332-13859354 CACTTCCTTCAAAATTTCAAAGG + Intergenic
1051501177 9:17779353-17779375 CCATTCCGTCAAATTTCCTGTGG - Intronic
1051516829 9:17939040-17939062 TAATTCTCTCAAATATCCATTGG + Intergenic
1053182813 9:35988377-35988399 CCATTTTTTCAACTTTCCATGGG + Intergenic
1053419932 9:37970884-37970906 CAGTGCTTTCAAATTTCCAAAGG - Intronic
1055771021 9:79717221-79717243 CAATTCCTTCACCTCCCCATAGG + Intronic
1055815295 9:80198165-80198187 CAATGCCTTCCAATTCTCATAGG + Intergenic
1056780315 9:89544231-89544253 AAATTTCTTCAAATGTTCATAGG - Intergenic
1058362425 9:104164699-104164721 CAATTCCTACAAAGTCTCATGGG - Intergenic
1058485873 9:105442964-105442986 CATTGCCTTCAAATTTCTTTAGG - Intergenic
1058905119 9:109476632-109476654 CTATTCCTTCAAACCTCCAGTGG - Intronic
1059956622 9:119522672-119522694 CTATTCCTGCAAGCTTCCATGGG + Intronic
1061316578 9:129799988-129800010 CATTTACTTCATATATCCATAGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187549917 X:20292175-20292197 AAATTCCATCAAATTCTCATAGG - Intergenic
1189089436 X:38064628-38064650 CAATTACATCAAATTTCTTTTGG + Intronic
1189666254 X:43357896-43357918 CAAGTCTCTCAAGTTTCCATGGG + Intergenic
1189684220 X:43547000-43547022 CACTTACTTAAAATTTCCATTGG + Intergenic
1189966158 X:46375993-46376015 CAAATTGTTCAAATATCCATAGG + Intergenic
1190752025 X:53370652-53370674 CAATGCCTTCAAAGTTCTGTGGG + Intergenic
1191937818 X:66443720-66443742 CAATTCCTTCAAATTAAACTGGG - Intergenic
1191974253 X:66852505-66852527 CACTTCCTTAAAATTTCAATAGG + Intergenic
1192545524 X:72009519-72009541 CACTTCCTTCACATCTCCACTGG + Intergenic
1195521182 X:105831364-105831386 GAATTACTTCAATTTTCCATTGG - Intronic
1196473896 X:116060037-116060059 CTGTTCCTTCTATTTTCCATGGG - Intergenic
1196486639 X:116218001-116218023 CTATACCTGGAAATTTCCATAGG + Intergenic
1196509234 X:116486804-116486826 CAATTCCTACAAAAGTCCAAAGG + Intergenic
1196630012 X:117927297-117927319 CAATGCCTTGAAATTGCCTTGGG - Intronic
1197918685 X:131564457-131564479 CTATTCCTTCCAACTTCCAAAGG + Intergenic
1197939991 X:131779196-131779218 CAAATCCTGTAAATTTCCCTTGG - Intergenic
1198604857 X:138325829-138325851 CAAGTCCCTAAAATTTCCTTGGG + Intergenic
1198697178 X:139354677-139354699 CCCTTCCTTCTAATTTCCACAGG + Intergenic
1198894336 X:141435541-141435563 CAATTCCATACAAATTCCATTGG + Intergenic
1198978370 X:142363309-142363331 GAAATCCTTCAATTTTTCATGGG + Intergenic
1199971053 X:152861466-152861488 CAATTTCTTCAAACTTCACTTGG + Intronic
1201537038 Y:15060979-15061001 CAAATTCTTTAAATTGCCATGGG + Intergenic