ID: 1080854128

View in Genome Browser
Species Human (GRCh38)
Location 11:36097057-36097079
Sequence GCTTTGTGCTGACCTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080854128 Original CRISPR GCTTTGTGCTGACCTTGTAC TGG Intronic
902207420 1:14879167-14879189 CCTGAGTGCTGACCTTGTGCTGG + Intronic
903913429 1:26745732-26745754 TCTTTTTGCTGGTCTTGTACAGG - Intronic
904451529 1:30615921-30615943 GCCCTGTGCTGGCCTTGTCCTGG - Intergenic
905384897 1:37595762-37595784 GGTTTGTGCTGGCCTTGGACGGG + Exonic
906654599 1:47538461-47538483 TGTTTGTGCTGACCTTGGGCTGG + Intergenic
907221617 1:52911299-52911321 GCTTTGTTCTGACCCTTCACGGG - Intronic
910770547 1:90827016-90827038 GCTTTTTGCTGACTTTGGGCTGG - Intergenic
922042432 1:221909707-221909729 GCTTTGTGGTAACCTTATAAAGG - Intergenic
922075357 1:222238339-222238361 GCTTTCTCCTGACCTTGTCCTGG + Intergenic
924283428 1:242461164-242461186 GCTATGTGCTGATATTGAACAGG - Intronic
1068874373 10:61980791-61980813 GTTTTGTGCTGACCCTGAACAGG + Intronic
1069901356 10:71708350-71708372 GCTTTGTGGTGAGCTTGGGCAGG - Intronic
1071342699 10:84663300-84663322 GCTTTATGCTGGCCATGTTCAGG + Intergenic
1071814586 10:89219781-89219803 GCTTTGTGCAGCCATTGTATCGG - Intronic
1073447951 10:103592283-103592305 CCTTTGTGCTGGCCTTGCAGTGG + Exonic
1077213694 11:1385499-1385521 GCTTGGTGCTGTCCTTGCAATGG - Intergenic
1079466049 11:20732064-20732086 GCTTTCTGCTGGGCTTGTTCAGG + Intronic
1080854128 11:36097057-36097079 GCTTTGTGCTGACCTTGTACTGG + Intronic
1083215772 11:61218788-61218810 GTTTTGTGATGACATTATACAGG - Intergenic
1083218656 11:61237617-61237639 GTTTTGTGATGACATTATACAGG - Intergenic
1084309016 11:68305183-68305205 GCTTGGTGCTGTCCTTGCAATGG + Intergenic
1086811360 11:91314300-91314322 GCTGTGTCCTGACCTGGTAGAGG - Intergenic
1091642210 12:2246069-2246091 GCTTTGTGGTGACTCTGAACAGG - Intronic
1094665563 12:32517093-32517115 GCTTTGAGCTGAGCTTGTTTTGG + Intronic
1096525503 12:52207810-52207832 TCTTTCTGCTGACCCTGAACAGG - Intergenic
1098392160 12:69981003-69981025 GCTTTGAGCTGAGCTTGATCAGG - Intergenic
1098989276 12:77047075-77047097 GCTTCGTGATCAGCTTGTACTGG - Intronic
1099479756 12:83151086-83151108 GCTTTTAGCTGACCTTGCAGAGG + Intergenic
1102483655 12:113241551-113241573 GCTTTCTGCTGACCTCTTGCAGG + Intronic
1103461740 12:121110451-121110473 GCTTTTGCCTGACCTTGGACGGG - Intergenic
1107379000 13:39835572-39835594 GCGCTGTGCTGCCCTTGTTCAGG + Intergenic
1112224547 13:97525635-97525657 GCTTTCTGTTGACCTTTCACTGG - Intergenic
1112306190 13:98276473-98276495 GCTATGTGATGATTTTGTACTGG + Intronic
1113148634 13:107237651-107237673 CATTTGTGCTGAACATGTACAGG - Intronic
1113419715 13:110161331-110161353 GCATTGTGCTGAACTTGCGCAGG + Exonic
1113784501 13:112995369-112995391 GCTTAGTGCTGACGGTATACTGG - Intronic
1121180333 14:91924123-91924145 CCTTGGTGATGACCTTGAACAGG - Intronic
1123851472 15:24361752-24361774 TCTCTGTGCTGTCCTAGTACAGG + Intergenic
1124505077 15:30265290-30265312 GCTTTGTGCTGATTTTGTGTTGG - Intergenic
1124738475 15:32273345-32273367 GCTTTGTGCTGATTTTGTGTTGG + Intergenic
1129519648 15:76177766-76177788 GCTCTGTGCTGGGCTTGTGCCGG + Intronic
1129672320 15:77614136-77614158 GCTTTGTGTTGCCCTTGCCCCGG + Exonic
1130940592 15:88505131-88505153 GCTTCCTGCTGACTTTGAACAGG - Intergenic
1135927809 16:26710653-26710675 TCTGTGTGCTCACCCTGTACTGG - Intergenic
1139419665 16:66842730-66842752 GCTCTTGGCTGACCTTGTACAGG - Intronic
1141234511 16:82203156-82203178 GCTTTATGCTGACCTTGTCCTGG + Intergenic
1141706336 16:85667231-85667253 GCCTTATTCTGACCTTGTCCTGG + Intronic
1143019093 17:3907432-3907454 GCTTTGAGCTCCCCTTGGACAGG - Intronic
1143038933 17:4017971-4017993 ACTTTGTGCTGCCCTTCTGCAGG - Exonic
1146472071 17:33132492-33132514 ACTGTGTGCAGACCTTGAACTGG - Intronic
1147219024 17:38917584-38917606 TCTTTGTCCTGAACTTGGACAGG + Intronic
1147504382 17:41000996-41001018 GATTTGTGCTGATCATGGACAGG - Intergenic
1153783654 18:8515622-8515644 GCTTTGTGCTTTCATTCTACTGG - Intergenic
1161868767 19:6854287-6854309 GCTGTGTGCAGACATTGTGCTGG + Intronic
1163513664 19:17750221-17750243 GCTTTGTGCTGGTACTGTACAGG + Intronic
1167498499 19:49832461-49832483 GCTTTCTGCTGACCTTTGACGGG + Intronic
1167818829 19:51907772-51907794 GCACTGTGCTGGCCTTGTATCGG - Intronic
929033434 2:37670375-37670397 GCTGTGTGCTGAGGTTGTAGGGG - Intronic
929295832 2:40245216-40245238 GATTTGTGCTGTTCATGTACAGG + Intronic
932213748 2:69952947-69952969 GTTCTGTGCTGCCCTGGTACGGG - Intergenic
934015956 2:87882049-87882071 GCTTGGTGCTGTCTTTGTAATGG - Intergenic
936237232 2:110753063-110753085 GCTTGGTGCTGACCTCCTGCTGG + Intronic
937843228 2:126548123-126548145 GATTTGTTCTGACCTTCTACTGG - Intergenic
941940956 2:171036810-171036832 ACTTTGTGCTGACACTGTAATGG + Intronic
942531005 2:176910405-176910427 GCTTTGGGCTGAAGTTCTACTGG - Intergenic
948402981 2:237697608-237697630 GCTGTGTGCTGCCCTGGTGCTGG + Intronic
1170066889 20:12321036-12321058 ACTATGTGCTGACCTTGGGCTGG + Intergenic
1172849430 20:37950068-37950090 GCTTGGTGCTGTCCTTGCAAGGG - Intergenic
1176163738 20:63662152-63662174 TCTGTGTGCTGACCTTGGGCGGG + Intronic
1182407031 22:30143821-30143843 GCTTTGTGCTGCCCTTGTAATGG + Intronic
955265293 3:57437511-57437533 GCTTTGTGCTTACCTAGGAAAGG - Intronic
956554111 3:70498734-70498756 GCTTTATGCTGTCCTGGTTCAGG - Intergenic
959447482 3:106458259-106458281 ACCTTGTGCTGACCTTGTCATGG + Intergenic
961765003 3:129203153-129203175 GCTTGGTGCTGTCCTTGCAATGG + Intergenic
961826667 3:129602777-129602799 GCTTGGTGCTTACTGTGTACTGG + Intronic
963282938 3:143404616-143404638 GATTAGTGCAGCCCTTGTACAGG - Intronic
967396595 3:189015902-189015924 CCTCTGTACTGACTTTGTACAGG - Intronic
972593878 4:40513304-40513326 ACTTAGTACTGTCCTTGTACAGG + Intronic
977370110 4:96124641-96124663 GCTTTCTGCTTCCCTTTTACAGG + Intergenic
979427691 4:120587954-120587976 GCTTAATGGTGACCTTGTAAGGG - Intergenic
983351557 4:166596976-166596998 GCTGTGTTCTGAACTTGCACGGG + Intergenic
986082489 5:4409328-4409350 CCTTTGTGCTGACCATTTGCTGG - Intergenic
986382885 5:7204488-7204510 CCTTTGTCCTGACCTTTTTCTGG - Intergenic
989370897 5:40706600-40706622 GCTTTGTGCTGAAGTTTTATAGG - Intergenic
990857567 5:60287230-60287252 GCTTTGTGCTGAAGTTATTCAGG - Intronic
992661756 5:78968821-78968843 GCTCTGTGCTGACCTTATGGTGG - Intronic
1008242776 6:49132178-49132200 GCTTTGTACTGAACATGTACAGG + Intergenic
1008808129 6:55456699-55456721 GCCTTCTGCTGACCATGGACAGG + Intronic
1010794966 6:80107696-80107718 GCTTAGTACTGAGCTTGTCCTGG + Intronic
1011146677 6:84225761-84225783 ACTTTGTGTTTACCTTTTACTGG + Intronic
1013542240 6:111122233-111122255 GATTTGTCCTGACCCTGGACCGG + Intronic
1013790441 6:113830320-113830342 GCTGTTAGTTGACCTTGTACTGG - Intergenic
1015525392 6:134171046-134171068 GCTTTGTCCTGTCCTTCTGCAGG + Exonic
1020452992 7:8341129-8341151 CCTTTGTGCTTACTTTCTACTGG + Intergenic
1020678473 7:11207683-11207705 GCTTTGAGCTGTGCTTGTACAGG + Intergenic
1023332427 7:39132512-39132534 GCTGAGTGCTGACTTTGTGCTGG - Intronic
1024736199 7:52307627-52307649 GCTTTATGCTCATCTTTTACTGG + Intergenic
1032693780 7:134316326-134316348 GCTCTCTGCCGACCTTGGACTGG + Intronic
1037345178 8:17891096-17891118 TCTTCGTGCTTACATTGTACAGG - Intronic
1038939722 8:32291058-32291080 GCTTTTTCCTGACTTTGGACTGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039671417 8:39604524-39604546 GCTTGGTGCTGTCCTTGCAATGG + Intronic
1044107808 8:88233696-88233718 GCTTTGTGCAGACACTGTGCAGG - Intronic
1045278882 8:100731283-100731305 GCTGTGTGCTGACCTTATTTGGG - Intergenic
1046486655 8:114896138-114896160 ACTTTGGGCTGACCTTCTCCTGG - Intergenic
1049350276 8:142160665-142160687 GCTTTGTGCTGAGCATGCAGGGG - Intergenic
1056840232 9:89992755-89992777 GCTTGGTGCTGACCTTGACCCGG - Intergenic
1059008699 9:110432981-110433003 GCTTGGTGCTGTCCTTGCAATGG + Intronic
1060174718 9:121488984-121489006 TCTTTGTGCTGACCTCTTTCTGG + Intergenic
1061079280 9:128360559-128360581 GCTTTGGTCTGGCCTTGTCCAGG - Exonic
1062070157 9:134551090-134551112 GCTCTTTGCTGTCCTTGGACTGG + Intergenic
1185776390 X:2805934-2805956 GCTTTGTGCTGATTTTGAAGTGG - Intronic
1192092431 X:68174212-68174234 GCTTTGTGTTGATCTTTTTCAGG - Intronic
1194066533 X:89268337-89268359 TGTTTGTGCAGCCCTTGTACAGG - Intergenic
1195990101 X:110673799-110673821 GGTCAGTGCTGACCTTGGACAGG - Intergenic
1199128535 X:144156497-144156519 GCTTGGTGCTGTCTTTGTAATGG + Intergenic
1201293587 Y:12445541-12445563 GCTTTGTGCTGATTTTGAAGTGG + Intergenic