ID: 1080856638

View in Genome Browser
Species Human (GRCh38)
Location 11:36117445-36117467
Sequence GCTGACTTCTGAACTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080856638 Original CRISPR GCTGACTTCTGAACTGATCT TGG Intronic
900185746 1:1332440-1332462 GCTGACCTCTGACCTGGTCATGG + Exonic
900731797 1:4266954-4266976 GCTGACTCCTGAATTGATGGTGG + Intergenic
903237029 1:21956798-21956820 GCTGTCCCCTGAACTGACCTGGG - Intergenic
903392780 1:22976494-22976516 GCTGCCTTCAGAACTGGGCTAGG - Intergenic
904070000 1:27787732-27787754 GCTTACTTTTTTACTGATCTTGG + Intronic
907175158 1:52514074-52514096 GATGACATCTCAACTGACCTTGG - Intronic
910439302 1:87236220-87236242 ATTGACTCCTGAACTGTTCTAGG + Intergenic
912318181 1:108685671-108685693 GCTCCCTTGTGAATTGATCTAGG - Intergenic
912488649 1:110048970-110048992 GCTGACTTCTGAGATGTCCTTGG + Intronic
913318701 1:117574158-117574180 GCTCACACCTGAACTGAGCTTGG + Intergenic
915672034 1:157497748-157497770 GCTGACTTTTGAGCCAATCTGGG - Intergenic
919025948 1:192170633-192170655 TCTGTCTTCTGTAATGATCTTGG - Intronic
919839418 1:201598196-201598218 GATGACGTCTGAGCTGAGCTTGG + Intergenic
921533569 1:216315941-216315963 GCTCACTTTAGAACTGATTTAGG - Intronic
922854527 1:228763165-228763187 ACTGACTTCTGATCTGTTCGCGG + Intergenic
923207247 1:231771076-231771098 GCTGATTTCCTAACTGATTTTGG + Intronic
1063469043 10:6269747-6269769 GCTGACTTCTGAAGTTGTCCAGG - Intergenic
1065831994 10:29622855-29622877 GCTGCCTTGTGAAGTGAGCTTGG + Intronic
1066296769 10:34060697-34060719 GCCCACCACTGAACTGATCTTGG + Intergenic
1066612236 10:37261387-37261409 GCTGAGTTCTGAAATAATTTGGG - Intronic
1067510726 10:46893010-46893032 ACTGACTTCAGAGCTGAACTGGG + Intergenic
1067651529 10:48158852-48158874 ACTGACTTCAGAGCTGAACTGGG - Intronic
1068324363 10:55465047-55465069 ACTGACTTTTAAACTCATCTTGG + Intronic
1068785660 10:60969947-60969969 GCTGACATCAGAACTGAAATGGG - Intronic
1069195096 10:65541917-65541939 GCTGTCTTCTCATCTGATCCTGG - Intergenic
1070376940 10:75841806-75841828 GCTTGCTCCAGAACTGATCTTGG + Intronic
1074429578 10:113382404-113382426 GCTGACTTCTAACCAGATGTCGG - Intergenic
1074538249 10:114344395-114344417 CCTGACTTCTGAACTTCTCAAGG + Intronic
1078909796 11:15720294-15720316 TCTGTCTTCCTAACTGATCTCGG - Intergenic
1080672271 11:34392050-34392072 GTTTACTTCTGCTCTGATCTTGG + Intergenic
1080856638 11:36117445-36117467 GCTGACTTCTGAACTGATCTTGG + Intronic
1082132942 11:48513253-48513275 GATGACTTCTTAATTGAGCTTGG - Intergenic
1082566374 11:54683811-54683833 GATGACTTCTTAATTGAGCTTGG - Intergenic
1086323825 11:85678208-85678230 GCTGACTTCAGAACTGGTGTAGG - Intronic
1086899552 11:92351278-92351300 GCTTACTTTTAAACTGATCAAGG - Intergenic
1087419494 11:97903195-97903217 GCTAACTTCAGAATTGATGTTGG + Intergenic
1088892538 11:114056508-114056530 GCTGGCTGCTGCACAGATCTTGG + Intergenic
1090145822 11:124321384-124321406 GCTGTCTTCTCAAGTGCTCTTGG - Intergenic
1091698952 12:2647404-2647426 TCTGACTGCTGAACTCATTTGGG - Intronic
1094763353 12:33561375-33561397 TTTGGGTTCTGAACTGATCTTGG - Intergenic
1104322471 12:127764578-127764600 GCTGGCCTCTGAGCTGAGCTTGG + Intergenic
1105225125 13:18424853-18424875 TCAGACTTCTGAACTGGTCAAGG - Intergenic
1108595394 13:51944608-51944630 CCTGACTCCTGACCTGATGTGGG - Intronic
1113746810 13:112750791-112750813 GATGACTTCTGACCTCTTCTGGG + Intronic
1120047358 14:79822877-79822899 GTAGACTTCTAAACTGATCTTGG - Intronic
1121015421 14:90546087-90546109 GCTGATTTCTGAGCTGCTCCTGG - Intronic
1122378835 14:101287224-101287246 GCTGGCATCTAAACTGATCCTGG - Intergenic
1126775286 15:52095008-52095030 GCTGACCTCTGACCTAGTCTAGG + Intergenic
1129274886 15:74438481-74438503 GGTGATCTCTGAACTGGTCTAGG - Intergenic
1130134750 15:81173236-81173258 GCTGACTACTGAATGCATCTTGG + Intronic
1131399884 15:92115991-92116013 TCTGGCTTCTGAGCTGCTCTTGG - Intronic
1132643041 16:986504-986526 GGTGGCTTCAGAAGTGATCTTGG + Exonic
1133469533 16:6061097-6061119 GGTGACTTCTGAAAAGACCTGGG - Intronic
1133528631 16:6631734-6631756 GCTGGTGTCTGAACTGACCTTGG + Intronic
1136375902 16:29864759-29864781 CATGAGTTCTGCACTGATCTGGG - Intergenic
1137929609 16:52574446-52574468 GCTGAAGTCTCAAATGATCTAGG + Intergenic
1138331603 16:56219935-56219957 TCTGACTTTTGAACTGACATGGG - Intronic
1140882011 16:79207025-79207047 GATGACCTCTGCACTGTTCTGGG + Intronic
1141853340 16:86663572-86663594 GCAGAATTCTGAACTGAAATTGG - Intergenic
1148134692 17:45284688-45284710 TCTGACTTGTGAACAGAACTTGG - Intronic
1154528241 18:15314669-15314691 TCAGACTTCTGAACTGGTCAAGG + Intergenic
1155737511 18:29242347-29242369 GCTGTCTGCTGAACTGAACAAGG + Intergenic
1156448820 18:37254814-37254836 GGTGACTTCTGACCTCATTTTGG - Intronic
1157302564 18:46489594-46489616 GCTGACACCTGAACTGATTCTGG - Intronic
1159973724 18:74684826-74684848 GCTGAGTTCTGATATGTTCTTGG - Intronic
1160188071 18:76691051-76691073 GTTTACTTCTAACCTGATCTGGG + Intergenic
1160268461 18:77361845-77361867 GCTCACTCCTGAGCTGATCATGG + Intergenic
1162985505 19:14266883-14266905 TCTGACTTCTCAGCTGCTCTGGG + Intergenic
1163163573 19:15480181-15480203 GCTGGCTTCTGGACTCACCTGGG + Intronic
1165276480 19:34756743-34756765 GATGACTTCAGAACTATTCTGGG + Intergenic
1167354547 19:48995173-48995195 GCTGAGTTTTGAAATGACCTTGG + Intronic
925909994 2:8567559-8567581 GCTGACTTCTGGAGGCATCTCGG - Intergenic
927006538 2:18855754-18855776 GCTGACATCTGAAGCCATCTGGG + Intergenic
927036130 2:19178454-19178476 GCAGACTTCTGATCTAGTCTTGG - Intergenic
927387709 2:22554928-22554950 AGTGACTTCTGAAATGATATTGG + Intergenic
927960071 2:27235611-27235633 GCTGACTTCTACACTGAGCATGG + Exonic
929342508 2:40838498-40838520 GCTGACCTTGGAGCTGATCTTGG - Intergenic
936787286 2:116108839-116108861 GCTGAGTTCAAAATTGATCTAGG - Intergenic
936944485 2:117918098-117918120 GGTGGCTTCTGAAATGATCAGGG + Exonic
938527345 2:132146132-132146154 TCAGACTTCTGAACTGGTCAAGG + Intergenic
940620056 2:156100954-156100976 GCTGACTCCTGTACTTGTCTTGG - Intergenic
940924198 2:159345520-159345542 GCTGACTGCTTAAATGTTCTTGG - Intronic
941473062 2:165913942-165913964 GTTTACTTCTGAAATGATGTGGG + Intronic
942525370 2:176847550-176847572 GCTGACTTCTAAAGTCATTTTGG - Intergenic
942719308 2:178932319-178932341 GCTTACTTCTGATATAATCTTGG - Intronic
944880755 2:204010682-204010704 GGTCACTTCTGGAGTGATCTTGG - Intergenic
946194296 2:218023906-218023928 GCTGACTTCTGAGGTCAGCTGGG - Intergenic
946953253 2:224899929-224899951 ACTGACTCCTGATGTGATCTTGG + Intronic
947667756 2:231917991-231918013 GCTGTCTTCAGAGCTGAGCTGGG - Intergenic
1175569074 20:60005606-60005628 GATGACTTCTGATCTTACCTGGG - Intronic
1175756721 20:61534960-61534982 GCTGGCTTCTGAATGGATCCAGG - Intronic
1176769177 21:13053871-13053893 TCAGACTTCTGAACTGGTCAAGG - Intergenic
1178344387 21:31812272-31812294 CCTGAAGTATGAACTGATCTTGG + Intergenic
1182803603 22:33052090-33052112 GCTGACTTGTGATATGAGCTTGG - Intronic
1185058099 22:48591727-48591749 GCTGAGCCCTGAACTGATGTGGG + Intronic
949870363 3:8582887-8582909 GCTGACATCTGAGTTGATCCTGG - Intergenic
960090855 3:113636729-113636751 CCTGACTTCTGAACTTATCTAGG + Intergenic
964735560 3:159913685-159913707 GCTGCCTTCTGAGCAGATGTAGG - Intergenic
966749542 3:183309070-183309092 GCTGACTTGTGTGCGGATCTGGG + Intronic
967732015 3:192915888-192915910 AGTGACATCAGAACTGATCTGGG + Intronic
968068423 3:195771668-195771690 GCTGACTTCTCCACTGGTCGGGG - Exonic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
975125285 4:70775598-70775620 GCATATTTCAGAACTGATCTTGG + Intronic
976380167 4:84389867-84389889 TCTTACTTCTGAACTGAGCCAGG - Intergenic
976979160 4:91204316-91204338 GCTGACTTTTGACCTCATCAAGG + Intronic
980369544 4:131849713-131849735 TCTGTCTTATGAACTGAGCTGGG - Intergenic
983086510 4:163451742-163451764 GTTTACTTCTGCTCTGATCTTGG - Intergenic
983912014 4:173250504-173250526 GCGGACCTCAGAAGTGATCTGGG - Intronic
985719179 5:1480395-1480417 GCTGACGTCTGAGCTGACGTCGG - Intronic
989334111 5:40294572-40294594 CGTGACTGCTGAACTGTTCTAGG + Intergenic
991559329 5:67932932-67932954 GATGAGTTTTGAACAGATCTTGG + Intergenic
993573855 5:89577410-89577432 GCTGAATTCAGAATTGTTCTAGG + Intergenic
995538369 5:113159932-113159954 GCTGCTTTCTGAGTTGATCTAGG - Intronic
996682641 5:126244848-126244870 TCTGACATTTGAACTGATATTGG + Intergenic
997662117 5:135597349-135597371 GGTGACTTCTGAATTGTCCTGGG - Intergenic
1000040210 5:157479737-157479759 GCTGCCTTCTCCAGTGATCTCGG + Exonic
1000718565 5:164678335-164678357 GCTGGATTCTGAAATTATCTGGG - Intergenic
1003642853 6:7889958-7889980 GCTGGCATGTGAACTGGTCTGGG - Intronic
1003997630 6:11558902-11558924 GCTGACTTCTGGGCTGGGCTTGG - Intronic
1006050086 6:31335650-31335672 CCAGACTTCTGAACTGGTCAGGG + Intronic
1006903373 6:37517012-37517034 GCTGTCTGCTGAGCTGAACTAGG - Intergenic
1007143390 6:39600981-39601003 ACTGAGTGCTGAAGTGATCTGGG + Intronic
1007690097 6:43695333-43695355 GCTCACATCTGCACTGCTCTTGG - Intergenic
1007797350 6:44360606-44360628 GCAGACTTCTGAAAAGACCTGGG - Intronic
1007819718 6:44552274-44552296 GCACACTTCTGAACTGAGCCAGG + Intergenic
1008454921 6:51698540-51698562 GCAGACTAATGATCTGATCTAGG + Intronic
1010885966 6:81240907-81240929 TGTGACTTCTGAGCTCATCTTGG - Intergenic
1014145627 6:117995027-117995049 CCTGACTTCTCAACTAATGTAGG + Intronic
1014658906 6:124141951-124141973 GCTGTGTTCAGAACTGGTCTAGG + Intronic
1014968949 6:127791281-127791303 GCTGACAGCTGAACAGATATTGG - Intronic
1019922727 7:4173266-4173288 AGTGACTTCTGCACTCATCTGGG - Intronic
1020118586 7:5490286-5490308 GCTGACTGCTGGAGTGATCAGGG - Intronic
1020287778 7:6698608-6698630 GCTGCATTCTGAACTGCTGTAGG - Intronic
1023798343 7:43811987-43812009 CCGGACTTCTGAACTGGTCAAGG - Intergenic
1024321115 7:48070636-48070658 GCAGACTCCTGAACAGGTCTTGG - Intergenic
1024586936 7:50850059-50850081 GCTGACTGTTGAATTGACCTAGG + Intergenic
1025172448 7:56771846-56771868 GCTGACTGCTGATCTGGCCTTGG - Intergenic
1025831440 7:65054654-65054676 GCTGACTGCTGATCTGGCCTTGG + Intergenic
1025918578 7:65888545-65888567 GCTGACTGCTGATCTGGCCTTGG + Intronic
1027957969 7:84906214-84906236 GCTGACATTTGAATTGATCTTGG - Intergenic
1028512924 7:91644897-91644919 CCTGACTTCCGAGCTTATCTGGG + Intergenic
1029924749 7:104303715-104303737 GGAGACATCTGAACTTATCTAGG + Intergenic
1030495679 7:110296811-110296833 GCTGACATCTGAGCTGATAGTGG - Intergenic
1033756099 7:144399143-144399165 GCTGACTTCTGACCAGACTTTGG - Exonic
1035221066 7:157406877-157406899 GCTGCCTTCAGAGCTGCTCTGGG - Intronic
1035397086 7:158541923-158541945 GCTGTTTTCTGAAGTGAGCTAGG - Intronic
1035645204 8:1213815-1213837 GCTGCCTCCTGACCTGGTCTGGG + Intergenic
1038735943 8:30169671-30169693 GTTGAATTCAGACCTGATCTAGG + Intronic
1039601976 8:38846944-38846966 GCTCCTTTCTGAACTGATCCAGG + Intronic
1041143585 8:54847615-54847637 GCTGACTGGTGAACTGTACTCGG + Intergenic
1042897678 8:73688680-73688702 GGTGGCTTCTGAACTGGTTTGGG + Exonic
1043419612 8:80085217-80085239 GTTGACTTCTGAACTGCCCTTGG - Intronic
1044486314 8:92758523-92758545 GCTGAATTCTGAATTCCTCTAGG + Intergenic
1046825018 8:118679468-118679490 GCTGAACCCTGAACAGATCTTGG - Intergenic
1050018083 9:1256595-1256617 CTTGTCTTCTGAACTGTTCTTGG + Intergenic
1050250643 9:3740715-3740737 GCTGTAATATGAACTGATCTCGG + Intergenic
1051039661 9:12791908-12791930 GCTGACTTCAGACCTGTCCTAGG + Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053347987 9:37392225-37392247 GTTGACCTCTGAACTCAGCTGGG - Intergenic
1053443867 9:38136704-38136726 ATTGACTTCTGAACAGCTCTTGG + Intergenic
1053633921 9:39975373-39975395 TCTGTCTTATGAACTGAACTGGG - Intergenic
1053771825 9:41488131-41488153 TCTGTCTTATGAACTGAACTGGG + Intergenic
1054209966 9:62275324-62275346 TCTGTCTTATGAACTGAACTGGG + Intergenic
1054315027 9:63573630-63573652 TCTGTCTTATGAACTGAACTGGG - Intergenic
1060472753 9:123962296-123962318 CCTCACCTCTGAACTCATCTGGG + Intergenic
1060898279 9:127233804-127233826 GCTCTTTTCTGAACTTATCTTGG - Intronic
1061265232 9:129500861-129500883 GCTGGCTTCTGAGCTGAGCTGGG + Intergenic
1187690167 X:21858457-21858479 TCTAACTTCTGTACTGATATAGG - Exonic
1191919878 X:66244212-66244234 GCTGGCTTCTCAAGTGAGCTAGG + Intronic
1194122214 X:89975458-89975480 GCTGATTTCTCAGCTCATCTTGG + Intergenic
1200475068 Y:3632893-3632915 GCTGATTTCTCAGCTCATCTTGG + Intergenic
1201705012 Y:16927758-16927780 GCTGCCTTCTGCCTTGATCTAGG - Intergenic