ID: 1080857529

View in Genome Browser
Species Human (GRCh38)
Location 11:36125145-36125167
Sequence GTGCAGACCCACAATCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080857529_1080857531 6 Left 1080857529 11:36125145-36125167 CCTTTATGATTGTGGGTCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1080857531 11:36125174-36125196 CTGTGCATTCCATGTAAGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 134
1080857529_1080857530 5 Left 1080857529 11:36125145-36125167 CCTTTATGATTGTGGGTCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1080857530 11:36125173-36125195 TCTGTGCATTCCATGTAAGCAGG 0: 1
1: 0
2: 0
3: 19
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080857529 Original CRISPR GTGCAGACCCACAATCATAA AGG (reversed) Intronic
903722243 1:25414267-25414289 GTGCAGATCCAGAATCACAGAGG - Intronic
908244065 1:62213759-62213781 GTGCAGTGGCACAATCATCAGGG + Intergenic
916293038 1:163187512-163187534 CTTAAGACCCACAATCACAAAGG - Intronic
919338822 1:196276509-196276531 GTAAAGACCCCCAAGCATAAAGG - Intronic
921466240 1:215491750-215491772 GGGAAGCCTCACAATCATAATGG - Intergenic
921830439 1:219722822-219722844 CTTAAGACCCACAATCAGAAAGG - Intronic
1068324916 10:55472348-55472370 GTGAAGAAACATAATCATAATGG - Intronic
1069018638 10:63461473-63461495 GTGTAGACCCAAAAACAAAAAGG + Intronic
1072170930 10:92861129-92861151 GTGGAGAAGCACAAACATAAGGG - Intronic
1074796757 10:116953980-116954002 GTTCAGAAGCACTATCATAACGG + Intronic
1075740094 10:124690032-124690054 GTGCACACCCACAATCAGGATGG - Intronic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1079835274 11:25326424-25326446 CTTAAGACCCACAATCAGAAAGG - Intergenic
1079921190 11:26436420-26436442 GAGCAGACCCTCAAACATATTGG - Intronic
1080857529 11:36125145-36125167 GTGCAGACCCACAATCATAAAGG - Intronic
1081749450 11:45499443-45499465 CTTCAGACCCACCATCAGAAAGG - Intergenic
1082938474 11:58678837-58678859 ATACAGACCCACAATAATAATGG - Intronic
1086628208 11:88985190-88985212 TTTCATACCCACAATCCTAAAGG + Intronic
1091542742 12:1477110-1477132 GTGTAGATCCACCTTCATAATGG + Intronic
1091770252 12:3146788-3146810 GTCCAGACGCACAAGCAGAAAGG - Intronic
1092177164 12:6417911-6417933 ATTTAGACCCACAATCAGAAAGG + Intergenic
1092495119 12:8985911-8985933 TTTAAGACCCACAATCAGAAAGG + Intronic
1094240957 12:28224243-28224265 AAGCAGACCCAAAATCATATGGG - Intronic
1094603782 12:31933242-31933264 CTTAAGACCCACAATCAGAAAGG + Intergenic
1097419131 12:59352245-59352267 ATGCAAACCCACACTCATACTGG + Intergenic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1099179531 12:79461178-79461200 GTGTAAACCCACTATGATAATGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1112643700 13:101306021-101306043 GTGAAGAGCCACAATTATAGAGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113649239 13:112023763-112023785 GTGAAGACTCACAATCATGGTGG + Intergenic
1119844215 14:77816416-77816438 GTTAAGATCCACAATCAGAAAGG - Intronic
1124649254 15:31462927-31462949 CTGGTGACCCACAATCAGAAAGG - Intergenic
1124836272 15:33198750-33198772 CTTAAGACCCACAATCAGAAAGG - Intergenic
1127369133 15:58320425-58320447 TTGCAGCCCAACAATCAAAAGGG + Intronic
1127787834 15:62371764-62371786 CTTAGGACCCACAATCATAAAGG + Intergenic
1134485117 16:14651791-14651813 CTTAAGACCCACAATCAGAAAGG + Intronic
1134500836 16:14768009-14768031 GTGCAGTGGCACAATCATAGTGG - Intronic
1134527362 16:14954548-14954570 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134545027 16:15101723-15101745 GTGCAGTGGCACAATCATAGTGG + Intronic
1134579746 16:15361040-15361062 GTGCAGTGGCACAATCATAGTGG + Intergenic
1134714963 16:16353158-16353180 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134722839 16:16396519-16396541 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134944589 16:18315352-18315374 GTGCAGTGGCACAATCATAGTGG + Intergenic
1134951852 16:18355501-18355523 GTGCAGTGGCACAATCATAGTGG + Intergenic
1135483569 16:22843837-22843859 CTGAAGACCCACAATCAGAAAGG + Intronic
1135678758 16:24439364-24439386 CTTAAGACCCACAATCAGAAAGG - Intergenic
1136149782 16:28339903-28339925 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136166018 16:28453707-28453729 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136196953 16:28661313-28661335 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136213292 16:28775436-28775458 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136258026 16:29055353-29055375 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136320467 16:29480956-29480978 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136435040 16:30220296-30220318 GTGCAGTGGCACAATCATAGTGG + Intergenic
1139494745 16:67308214-67308236 GTGCAGTCGTACAATCATCATGG + Intronic
1139855072 16:69973685-69973707 GTGCAGTGGCACAATCATAGTGG + Intergenic
1139884789 16:70200818-70200840 GTGCAGTGGCACAATCATAGTGG + Intergenic
1140367730 16:74394707-74394729 GTGCAGTGGCACAATCATAGTGG - Intergenic
1140835274 16:78788408-78788430 CTGAAGACTCACAATCAAAAAGG - Intronic
1141935031 16:87232656-87232678 TTGCAGACCCTCAAGCAAAATGG + Intronic
1142309445 16:89303749-89303771 CGGCAGCCACACAATCATAAAGG + Intronic
1149500315 17:57147528-57147550 CTTAAGACCCACAATCAGAAAGG - Intergenic
1151895569 17:76978304-76978326 GGGAAGACTCACAATCATAGTGG - Intergenic
1152175730 17:78785978-78786000 CTTAAGACCCACAATCAGAAAGG - Intergenic
1155233227 18:23794214-23794236 CTTAAGACCCACAATCACAAAGG + Intronic
1155385707 18:25275097-25275119 GTGCAAACACTCAATCATCAAGG + Intronic
1155720624 18:29007282-29007304 GTCCATACCTACAAACATAATGG + Intergenic
1160463694 18:79058231-79058253 GTGCTGACCCAGAGCCATAAGGG + Intergenic
1161826104 19:6566878-6566900 GGGCAGCCTCACAATCATGAAGG + Intergenic
1162620202 19:11836931-11836953 TTTAAGACCCACAATCAAAAAGG + Intergenic
1162637541 19:11981875-11981897 TTTAAGACCCACAATCAAAAAGG + Intergenic
1165258124 19:34592295-34592317 GTGCAGACCCACCTTCAGCAGGG - Intergenic
1165294719 19:34917229-34917251 CTTAAGACCCACAATCAGAAAGG + Intergenic
1165977827 19:39692659-39692681 CTCCAGACCCACAATAAGAAGGG - Intergenic
1166340020 19:42131975-42131997 GTGCACACACACACTCAAAAGGG + Intronic
1167102032 19:47409505-47409527 GTACAGACCCACTATCCTCATGG + Exonic
925131675 2:1498202-1498224 TTCCAGACCCTCAGTCATAAAGG + Intronic
925457535 2:4028753-4028775 GGGAAGCCTCACAATCATAATGG - Intergenic
927590636 2:24354313-24354335 GTACAGACCCACAATCCCACTGG - Intronic
927878521 2:26674592-26674614 GTGCAGAGCCACAATCTCTAAGG - Intergenic
930609791 2:53528981-53529003 GTGCAGACCCAAAATTCTAGGGG + Intergenic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
937397938 2:121555086-121555108 GTGCAGACCCAGAGTCCTAATGG + Intronic
937892983 2:126954125-126954147 AGGCAAATCCACAATCATAATGG - Intergenic
947537638 2:230950818-230950840 CTTAAGACCCACAATCAGAAAGG - Intronic
1169358897 20:4930922-4930944 GGGCAGTCGTACAATCATAATGG - Intronic
1175012600 20:55754646-55754668 GTTAAGACCCACAATCAGAAAGG + Intergenic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1184727640 22:46355998-46356020 GTGCTGACCCTCAATCAAGATGG + Exonic
951843100 3:27056086-27056108 ATGCAGCCACACAATAATAATGG - Intergenic
952086662 3:29830502-29830524 ATGCATAACCACAATCAAAAGGG - Intronic
953085518 3:39662392-39662414 GTCCTCACCCCCAATCATAAAGG - Intergenic
953141348 3:40232089-40232111 ATGCAGACCCACTAGAATAAGGG - Intronic
953560490 3:43986661-43986683 GAGAAGACCCAAAATCAGAAAGG - Intergenic
954065784 3:48104820-48104842 CTGAAGACCCACAGTCAGAAAGG + Intergenic
954257337 3:49415920-49415942 GTGCAGACCCACATTCCCATAGG - Exonic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
960170144 3:114451386-114451408 GGGCAGACCAACAAGCATATAGG + Intronic
960396525 3:117144213-117144235 GAGCAGACCCCCAGTGATAATGG - Intergenic
961693630 3:128688667-128688689 CTGAAGACCCACAATCAGAGAGG - Intergenic
965082623 3:164054093-164054115 CTTAAGACCCACAATCAGAAAGG + Intergenic
970234071 4:13940583-13940605 CTTAAGACCCACAATCAGAAAGG + Intergenic
970321508 4:14879923-14879945 TTTCAGTCCCACAATCCTAAGGG + Intergenic
972869153 4:43274580-43274602 GTGAATAACCACAACCATAATGG + Intergenic
972939938 4:44183074-44183096 GTGCAGACCCAGAATCAGTGTGG - Intronic
973134780 4:46693474-46693496 ATGCACACACACAATTATAAAGG + Intergenic
975875261 4:78828510-78828532 TTTAAGACCCACAATCAGAAAGG + Intronic
977046634 4:92076552-92076574 CTTAAGACCCACAATCAGAAAGG - Intergenic
980308741 4:131100024-131100046 GGGGAGCTCCACAATCATAATGG - Intergenic
982772930 4:159414733-159414755 CTTCAGACCCACAATCAGAAAGG - Intergenic
982985496 4:162201008-162201030 CTTAAGACTCACAATCATAAAGG + Intergenic
986927540 5:12775255-12775277 GTGCAAAAGCAAAATCATAAAGG + Intergenic
987779436 5:22415416-22415438 GACTGGACCCACAATCATAATGG - Intronic
989371639 5:40716821-40716843 GGGCTAACCCACAATCACAAAGG + Intronic
993158675 5:84259896-84259918 ATGCACAACCACAATCATAAAGG - Intronic
995240794 5:109884011-109884033 GTTCAGATCCAGAATCATCAGGG + Intronic
996661903 5:126013909-126013931 ATGCATACACACACTCATAAGGG + Intergenic
1004469231 6:15914154-15914176 GTGCATACCCAGAAGCAGAATGG - Intergenic
1005808591 6:29498869-29498891 GTCCAGACACAAAATCAAAAAGG - Intergenic
1007551415 6:42732769-42732791 CTTAAGACCCACAATCAGAAAGG + Intergenic
1016655763 6:146516701-146516723 ATGCAGACCCTTAATCAAAAAGG + Intergenic
1020739359 7:11993860-11993882 GTGCAGGCACAAATTCATAAAGG - Intergenic
1021081270 7:16368553-16368575 GTGCACACACAAAATCAGAAAGG - Intronic
1021860151 7:24897858-24897880 GTGCAGACCCCCAGGCCTAATGG - Intronic
1023040859 7:36172277-36172299 GAAAAGACCCACAATCAAAAAGG - Intronic
1024536324 7:50437512-50437534 CTTAAGACCCACAATCAGAAAGG + Intergenic
1026624635 7:71981287-71981309 CTTAAGACCCACAATCAGAAAGG - Intronic
1037180891 8:16004598-16004620 GTGCATACCCACAAAAATCATGG + Intergenic
1037650315 8:20831513-20831535 GTGCAAACCCATAATAATCATGG - Intergenic
1039803828 8:40982339-40982361 CTTAAGACCCACAATCAGAAAGG - Intergenic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1045221147 8:100201716-100201738 CTTCTGACCCACAATCAGAAAGG - Intronic
1047593557 8:126352805-126352827 GGCCACACCCACAGTCATAAAGG + Intergenic
1050283656 9:4078638-4078660 TGGCAGCACCACAATCATAATGG - Intronic
1050622841 9:7472907-7472929 ATGAAGCCCCACAATCATGAAGG - Intergenic
1051558073 9:18407314-18407336 GTGCAGACCCAAAAGCATGAGGG + Intergenic
1052008358 9:23377424-23377446 CTGCCTACCCAAAATCATAATGG + Intergenic
1052949155 9:34193895-34193917 GTTAAGACCCACAATCAGAAAGG + Intronic
1052987845 9:34501312-34501334 GGGAAGACCCACAATCCTACTGG + Intronic
1061485632 9:130919275-130919297 GAGCACACACACATTCATAATGG - Intronic
1185941619 X:4327077-4327099 GTGAAAACTGACAATCATAAGGG - Intergenic
1189287828 X:39864758-39864780 GTGCAGACCCACAGTCACCCAGG - Intergenic
1189340803 X:40203185-40203207 CTTAAGACCCACAATCAGAAAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1199466976 X:148149112-148149134 GTGCAAAGCCACAATAATTAAGG + Intergenic
1199505118 X:148552630-148552652 GAGCAGACCAACAAGCATAGTGG - Intronic