ID: 1080858197

View in Genome Browser
Species Human (GRCh38)
Location 11:36130369-36130391
Sequence ATGTGTCCACGGGGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080858197 Original CRISPR ATGTGTCCACGGGGGCTGGA AGG Intronic
900144524 1:1152152-1152174 ACGAGGCCACGGGGCCTGGATGG - Intergenic
901240665 1:7691307-7691329 ATCAGGCCACAGGGGCTGGAGGG + Intronic
904640010 1:31919038-31919060 AGATCTCCACAGGGGCTGGACGG + Exonic
906825145 1:48971368-48971390 ATTTTTCCACTGGGGGTGGAGGG - Intronic
909923268 1:81407742-81407764 ATGTGTCCAAGAGGACTTGATGG + Intronic
913076862 1:115347556-115347578 ATGTGTGCTGGGGGGCTGTATGG - Intergenic
916069516 1:161161675-161161697 AAGGGGCCACGGGGGCAGGAGGG + Intronic
919540478 1:198839286-198839308 AGGTGGCCAGTGGGGCTGGAAGG + Intergenic
924049233 1:240063631-240063653 ATGTCTGAACGGGGGCTGGTTGG - Intronic
1063496455 10:6513702-6513724 ATGTGTTCAGAGTGGCTGGAAGG + Intronic
1068741976 10:60483716-60483738 ATGAGTTCCTGGGGGCTGGAGGG - Intronic
1069887734 10:71634513-71634535 ATATGGCCACTGGGGCTGGGAGG + Intronic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1072834380 10:98695446-98695468 AAATGTCAACGTGGGCTGGAGGG + Intronic
1073147187 10:101288605-101288627 AGATGTCCAGGGGGGCTGCACGG - Intergenic
1073185981 10:101615317-101615339 CTTTGTCCACGGGAGTTGGAAGG - Intronic
1076568245 10:131413305-131413327 CTGTGTCCACGGGAACTGAAGGG + Intergenic
1076826802 10:132973441-132973463 CTGTGCCCACTGGGGATGGATGG + Intergenic
1076897921 10:133323200-133323222 CTGTGTCCACGTATGCTGGATGG - Intronic
1078922486 11:15843465-15843487 ATGTAACCACCAGGGCTGGAAGG - Intergenic
1080858197 11:36130369-36130391 ATGTGTCCACGGGGGCTGGAAGG + Intronic
1082935925 11:58656599-58656621 ATTTGTTGCCGGGGGCTGGAGGG - Intronic
1083688673 11:64392978-64393000 CTTTATCCATGGGGGCTGGAAGG + Intergenic
1084923052 11:72487401-72487423 ATGTGTCAATGGAGGCTGGGTGG + Intergenic
1084973555 11:72784231-72784253 ATGAGCCCAGGAGGGCTGGAGGG + Intronic
1085812779 11:79700450-79700472 ATGTGTGCACAGGTGCTGGCAGG + Intergenic
1086103928 11:83129175-83129197 CTGTGTCCACAGGGGCTGACAGG - Intergenic
1089410774 11:118240716-118240738 GTGTGTCTGCGGGGGATGGAAGG - Intronic
1089567412 11:119379007-119379029 CTGTGTCCAGGGGCACTGGATGG + Intronic
1091248826 11:134124300-134124322 AAATCTCCACAGGGGCTGGACGG + Intronic
1092145238 12:6210216-6210238 CTGTTTTCACGGGGGATGGAAGG + Intronic
1092408842 12:8239131-8239153 ATGTGTCCCTGGGGACAGGATGG + Intergenic
1092445714 12:8555005-8555027 TTGTGTCCACGGAGTCTGCAGGG + Intergenic
1096232507 12:49904120-49904142 ATGGGTCCGCGGGGGCTGAGCGG + Intronic
1096750440 12:53755639-53755661 AAGTGTCCACAGGGGTGGGATGG + Intergenic
1103368202 12:120398386-120398408 AAGTGGCCATGGGGGCAGGAGGG - Intergenic
1104487988 12:129168437-129168459 AGGGGTCCACAGGGGCTGGCAGG - Intronic
1105004736 12:132714471-132714493 AAGTGTCCACGGGGCCAAGATGG - Intronic
1105651547 13:22383957-22383979 AAGTGTCCATGGTGGCTAGAAGG - Intergenic
1112793506 13:103029634-103029656 ATGGGTCCAAGGGTGCTGGCTGG + Intergenic
1113922147 13:113919231-113919253 CTGTGGCCCCGGGGGCTGTAGGG - Intergenic
1114228233 14:20757923-20757945 ATCTGCCCAGGGGGGCTGGTGGG - Intergenic
1119644322 14:76337548-76337570 GTGTGTGGGCGGGGGCTGGATGG + Intronic
1124209663 15:27752748-27752770 CTGTGTCCAGAGGGACTGGACGG - Intergenic
1125424758 15:39537654-39537676 ATATATCCAAGGTGGCTGGAGGG - Intergenic
1129526325 15:76217663-76217685 AGCTGTCCAAGGGGGCTGCAGGG + Intronic
1130321280 15:82844188-82844210 ATGAGTACAAGGGGGATGGAGGG + Intronic
1131699336 15:94917226-94917248 ATGTGTGGCCGGTGGCTGGAAGG + Intergenic
1132481242 16:167189-167211 AAGTGTCCATGGGGGAAGGAAGG - Intergenic
1132544311 16:526316-526338 ATGTGTCCCCGGGGGCCAGTGGG - Intergenic
1132648553 16:1010196-1010218 CTGTGTCCACTGTGGATGGAGGG + Intergenic
1132697527 16:1208593-1208615 CTGGGTCCAGGGGGACTGGAGGG + Intronic
1134070133 16:11255666-11255688 CTGTGTCCACTGAGGCTGAACGG - Intronic
1134156126 16:11844693-11844715 CTGTGTCCACTGGGTCTGCACGG + Intronic
1135947357 16:26876825-26876847 ATGTTTCCACGGGCACTGGAAGG + Intergenic
1136654882 16:31703710-31703732 ATCTGTCACCGGGGCCTGGAGGG + Intergenic
1137612155 16:49825822-49825844 CTGTGTCTTAGGGGGCTGGATGG - Intronic
1138390475 16:56667049-56667071 AAGGGTCCTCTGGGGCTGGAGGG - Intronic
1139689559 16:68631571-68631593 TTGAGCCCAGGGGGGCTGGAGGG + Intergenic
1140357531 16:74319184-74319206 ATGGGTCCCCTGGAGCTGGAGGG - Intergenic
1140482030 16:75266995-75267017 AGGAGGCCACGGTGGCTGGATGG + Intronic
1140871599 16:79111821-79111843 GTGTGTCCACTGGGCCTGGCAGG + Intronic
1142063190 16:88044189-88044211 ATGAGTGCACGCGGGCTGCATGG + Intronic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1142224594 16:88871437-88871459 AAGTGTGCACGGGAGCTGGCGGG + Intergenic
1143780822 17:9228442-9228464 GCGTGTCCACGTGAGCTGGAGGG - Intronic
1144947846 17:18978899-18978921 ATGGGTGCACGGGGGCTGGGCGG - Intronic
1145790582 17:27624233-27624255 ATCTGACCATGAGGGCTGGATGG + Exonic
1146183516 17:30710959-30710981 ATGTGTGCCTGGGGGCAGGAGGG + Intergenic
1150160922 17:62897169-62897191 ATGTGTCCAGGTTGGCTGGCTGG - Intergenic
1150292721 17:63990821-63990843 CTGTGTCCACAGGGTCTGGGCGG - Intergenic
1151665900 17:75545000-75545022 CGGTGTCCACGGGAGATGGAAGG + Intronic
1152330732 17:79671133-79671155 GGGTGTCCATGGGGGCTGCAGGG + Intergenic
1152463014 17:80451078-80451100 GTGTGTCCTCGGGGGCTGGGTGG + Intergenic
1152707587 17:81852760-81852782 ATGTGTCCGCGAAGGCTGGGAGG - Intronic
1155536740 18:26826431-26826453 ATGTGAGCACCGTGGCTGGAAGG + Intergenic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1158277766 18:55787077-55787099 ATCTGTCCACTGGGCCTGGCTGG - Intergenic
1159498944 18:69243326-69243348 ATGTGTCCAGGGGGACTAGGTGG - Intergenic
1160759410 19:775430-775452 GTGTGTCCACGGGGGGGGGCGGG + Intergenic
1160881579 19:1323266-1323288 CTGTGACCCCGGGGGCAGGATGG - Intergenic
1161118717 19:2513288-2513310 CTGTCTCCACTGGGGCCGGAGGG + Exonic
1161204610 19:3034468-3034490 ATCTGGCCAGGGTGGCTGGAGGG - Intronic
1161237059 19:3203578-3203600 CTGTGGACACTGGGGCTGGATGG - Intronic
1161480285 19:4506954-4506976 CTGTGGACACGGGGGCTAGATGG + Intronic
1162975274 19:14204802-14204824 ATGTGTGCCTGGGGGCAGGAGGG - Intronic
1163764133 19:19153040-19153062 ATGGGTCCCTGGGGGGTGGACGG + Intronic
1165748401 19:38244964-38244986 ATGTGGCCACGGGTCATGGAGGG + Intronic
931279445 2:60776170-60776192 ATGTGTCCACTGGAGCTCGTGGG + Intronic
941691073 2:168501326-168501348 CTGTTTCCAGTGGGGCTGGAGGG + Intronic
944536554 2:200716222-200716244 AGGTGACCACGGTGGCTGGAAGG + Intergenic
947352566 2:229261659-229261681 CTGTGTCCATGGGAGCAGGAGGG - Intronic
947727833 2:232410752-232410774 ATGTGGACACAGTGGCTGGAGGG + Intergenic
948462081 2:238134599-238134621 ACGTGTCCCCGGGGGCAGGCAGG + Intergenic
948577915 2:238965974-238965996 TCCTGCCCACGGGGGCTGGAGGG - Intergenic
948665941 2:239535114-239535136 ATGGGTCCACGGGGGAAGGACGG - Intergenic
948863385 2:240763648-240763670 ATGTGTGCACAGGGGCTTGGGGG - Intronic
948965446 2:241376180-241376202 ATGAGGCCAAGTGGGCTGGAGGG - Intronic
1170533503 20:17317390-17317412 ATGGGTCAACTGGGTCTGGAAGG - Intronic
1175253415 20:57623233-57623255 ATGTGGCCACGGGGACAGAAAGG - Intergenic
1175358710 20:58389931-58389953 AGGTGTGCACGGTGGCTGGGTGG - Intronic
1175839966 20:62020392-62020414 TTGTGTCCCCGTGGGCTGGCAGG - Intronic
1176052584 20:63128197-63128219 CTGTGTTCACAGGGGCTAGAGGG - Intergenic
1181165379 22:20980310-20980332 ATGTGTTCATGGTGGATGGAAGG + Intronic
1183751641 22:39724272-39724294 ATGATTCCACCAGGGCTGGAAGG - Intergenic
1184452923 22:44593496-44593518 TTGTGTCCCCAGGGTCTGGAGGG - Intergenic
1184744401 22:46447967-46447989 ATGAGGCCATGAGGGCTGGATGG - Intronic
1184917421 22:47579731-47579753 GTGTGTCGGCGGGGGTTGGAGGG - Intergenic
1184920152 22:47600459-47600481 ATGTGTTCACAGAGGCTGGGGGG - Intergenic
949895183 3:8763165-8763187 ATGTGTCCGGGGAGGCTGGGAGG - Intronic
951997004 3:28742017-28742039 AGGTGTTCACGGAGACTGGATGG + Intergenic
953035452 3:39206758-39206780 ATTTGCCCACGGGGGCTGCCTGG - Intergenic
953078480 3:39593518-39593540 TTGTGTTCACGGGTGCTTGATGG + Intergenic
955744853 3:62130142-62130164 ATGGTTCCACTGAGGCTGGATGG + Intronic
959249678 3:103926114-103926136 ATGTGTCCACGGTGGCTTGGAGG - Intergenic
960167671 3:114422043-114422065 GTGTGTTCAACGGGGCTGGAGGG - Intronic
960255897 3:115511311-115511333 ATGTGACAACAGAGGCTGGAGGG + Intergenic
960876302 3:122298401-122298423 ATGTGTCCACTGGGGGAGGCAGG + Intergenic
960989781 3:123303029-123303051 CTGGGTGCACAGGGGCTGGAAGG - Intronic
964817613 3:160733205-160733227 TTGTGTCCACATGTGCTGGATGG - Intergenic
965042875 3:163533602-163533624 ATGTGGCCACAGTGGCTGAAAGG + Intergenic
968557203 4:1251585-1251607 ATGTGGCAACGGAGGCTGGCCGG - Intergenic
969188919 4:5501455-5501477 ATGTGTCGACGAGAGCTGAAAGG - Intergenic
969817047 4:9694640-9694662 ATGTGTCCCTGGGGACAGGATGG - Intergenic
973200684 4:47498385-47498407 AAATGTCCTAGGGGGCTGGAAGG + Intronic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
981911625 4:149988023-149988045 ATGATTCCACGGGGGCAGAATGG + Intergenic
984475328 4:180227732-180227754 ATGTGTCCTCCTGGGCTTGAAGG + Intergenic
986020319 5:3795550-3795572 AGGTGTCCACGGGGGTTGGGGGG + Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
988498459 5:31764480-31764502 ATGTGTACAGGAGGGCAGGAGGG - Intronic
989597308 5:43168454-43168476 ATGTGGCCAAAGGGGTTGGAAGG + Intronic
989710108 5:44388187-44388209 ATGTATACACGGGGGTTGGGGGG + Intronic
990148255 5:52787706-52787728 AAGTGTCCGCAGGGGATGGAAGG + Intergenic
994305517 5:98199261-98199283 ATGTGTGCATGGGGGCAGGGTGG + Intergenic
998390057 5:141781596-141781618 ATGTGTGCAAAGGGGCTGGGAGG - Intergenic
998501877 5:142640375-142640397 AGGAGCCCACGGGGGCTGGAAGG + Intronic
998569299 5:143243185-143243207 CAGTGTCCTCTGGGGCTGGAAGG - Intergenic
1003126315 6:3358850-3358872 ATCTGCCATCGGGGGCTGGAGGG + Intronic
1005919779 6:30390711-30390733 ATGTGTCTACTGGGTCTGTAGGG - Intergenic
1006083837 6:31582395-31582417 ATGGGGGCACTGGGGCTGGAGGG - Exonic
1007514390 6:42399846-42399868 ATCTGACCATGGGGGATGGATGG - Intronic
1007582179 6:42966221-42966243 AGGTGGCCAGGGGGCCTGGAAGG - Exonic
1007842844 6:44730806-44730828 GTCAGTCCAGGGGGGCTGGAGGG - Intergenic
1009907626 6:69888950-69888972 ATGTGTACAGGGGGGCTGAGGGG + Intronic
1013944255 6:115703793-115703815 ATCTGTCCACTGGGTCTGCAGGG + Intergenic
1014791774 6:125680849-125680871 ATTTATCCAGGGTGGCTGGATGG + Intergenic
1016075427 6:139789333-139789355 AAGTGTCCATGGGGGTTGTAGGG + Intergenic
1018726232 6:166615316-166615338 GGGAGTCCACGGTGGCTGGAAGG - Intronic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1020073127 7:5240448-5240470 CTGTGTCCTTGGGGGCTGGGCGG + Intergenic
1023856302 7:44186167-44186189 AGGTGTCCAGGGCAGCTGGAGGG + Intronic
1027051105 7:75021711-75021733 ATGGGTCCAGGGTGTCTGGAAGG + Intronic
1031424378 7:121587608-121587630 ATGTGGCCACAAGGGCTAGAGGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035279898 7:157771219-157771241 AGTGGTCCAAGGGGGCTGGAGGG - Intronic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1037515490 8:19627343-19627365 ATGGATCCACGGCTGCTGGAAGG + Intronic
1037935663 8:22913534-22913556 GTGTGGCCGCAGGGGCTGGAGGG - Intronic
1038478226 8:27883901-27883923 ATTTGGCCAAGTGGGCTGGAAGG + Intronic
1039897312 8:41725490-41725512 ATGTGTCCAGGCGGGCAGGGCGG - Intronic
1040447519 8:47510939-47510961 GTGTGTACAAGGGGGCAGGAGGG + Intronic
1041110393 8:54477549-54477571 ATATTTCCACGGGAGCTGGGGGG + Intergenic
1041480853 8:58318403-58318425 GTGTGTCCACGGGTGCAGAAGGG + Intergenic
1042607376 8:70558866-70558888 ATTTCTCCAAGTGGGCTGGAAGG - Intergenic
1043053472 8:75408486-75408508 ATGTGTCCATGAGAGATGGATGG - Intronic
1044383985 8:91565799-91565821 AAGTGTCCAAGGGATCTGGAGGG + Intergenic
1045327531 8:101127758-101127780 CTGCCTCCCCGGGGGCTGGAAGG + Intergenic
1045942501 8:107755347-107755369 ATGTGGCCAGGGCGGCTGGAGGG + Intergenic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047323901 8:123818170-123818192 ATGTGTCCTCACGGGGTGGAGGG + Intergenic
1049519111 8:143079312-143079334 GTGTGACCACCTGGGCTGGAGGG + Intergenic
1053119916 9:35538779-35538801 AAGGGCCCACAGGGGCTGGAAGG + Exonic
1053650275 9:40161692-40161714 ATGTTTCTACTGGGGCTTGAAGG + Intergenic
1053755463 9:41302235-41302257 ATGTTTCTACTGGGGCTTGAAGG - Intergenic
1054534306 9:66214511-66214533 ATGTTTCTACTGGGGCTTGAAGG - Intergenic
1054744632 9:68842233-68842255 ATGTGTCCATGGAGGCAGGGAGG + Intronic
1059402269 9:114077778-114077800 GTGTCTGCACGGGGGCTGCAGGG + Intronic
1061379347 9:130244763-130244785 CTGTGGCCACTGGGGCTGGGTGG - Intergenic
1062179092 9:135181101-135181123 AAGGGTCCCCGTGGGCTGGAGGG + Intergenic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1202798168 9_KI270719v1_random:146376-146398 ATGTTTCTACTGGGGCTTGAAGG + Intergenic
1188212779 X:27444005-27444027 ATGTGTCCCGGGGGGAGGGAAGG + Intergenic
1190968947 X:55330395-55330417 AGGTGTCCACAGTGGCAGGATGG - Intergenic
1191075163 X:56445144-56445166 ATGTGTCTAGGGAGGATGGAAGG + Intergenic
1196222646 X:113129432-113129454 ATATGTCCACGGGGCATGCACGG - Intergenic
1200837839 Y:7750193-7750215 ATGTGGGAACGGGGGCTGGGTGG + Intergenic
1201233187 Y:11885617-11885639 ATGTTACTACGGAGGCTGGATGG + Intergenic