ID: 1080859723

View in Genome Browser
Species Human (GRCh38)
Location 11:36142728-36142750
Sequence GAAAATGCCTGGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080859723_1080859729 16 Left 1080859723 11:36142728-36142750 CCCAGCTGCAGCCAGGCATTTTC 0: 1
1: 0
2: 1
3: 20
4: 279
Right 1080859729 11:36142767-36142789 TCTGCATTACTACCTCTTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 209
1080859723_1080859730 27 Left 1080859723 11:36142728-36142750 CCCAGCTGCAGCCAGGCATTTTC 0: 1
1: 0
2: 1
3: 20
4: 279
Right 1080859730 11:36142778-36142800 ACCTCTTCCAGGTTATCTAAAGG 0: 1
1: 0
2: 2
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080859723 Original CRISPR GAAAATGCCTGGCTGCAGCT GGG (reversed) Intronic
900325694 1:2107770-2107792 GGAAATCCCTGGATGCTGCTGGG - Intronic
902636690 1:17739442-17739464 GACGATGCCCGGGTGCAGCTGGG - Intergenic
904311072 1:29629953-29629975 GAGCAGGCCTGGCTGCAGCGAGG - Intergenic
905219452 1:36434414-36434436 GGAAATGTTTGGCTGCAGGTAGG - Intronic
905491776 1:38349865-38349887 GAAAATATCTGGCTGCCTCTAGG - Intergenic
905539859 1:38751800-38751822 GCAAATGCATGTCAGCAGCTTGG - Intergenic
905658463 1:39701646-39701668 GGAAATGCCTGGCTCAAGCTGGG + Intronic
908834171 1:68211875-68211897 GATTCTGCCTGGCTGCATCTGGG + Intronic
910478557 1:87634326-87634348 AAAAATGCCTGTCTTCACCTAGG + Intergenic
912274524 1:108242285-108242307 GGAAATGCCTGCCTGGAGCCTGG - Intronic
912286743 1:108377573-108377595 GGAAATGCCTGCCTGGAGCCTGG + Intronic
912293695 1:108452056-108452078 GGAAATGCCTGCCTGGAGCCTGG + Intronic
913060214 1:115197643-115197665 GGACAAGCCTGGCTGCAGTTAGG - Intergenic
913943681 1:125135935-125135957 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
913943682 1:125135942-125135964 GAATATGCCTTGATGCAGCCAGG - Intergenic
914362128 1:146944467-146944489 GAAGCTGCCCGGCTGCAGGTGGG - Intronic
914489498 1:148142488-148142510 GAAGCTGCCCGGCTGCAGGTGGG + Intronic
915871339 1:159562799-159562821 GCCAATGCCTGTCTGCAGCAAGG - Intergenic
916048456 1:161018243-161018265 GCAAAGGCCTGGCCCCAGCTTGG - Intronic
916201099 1:162272372-162272394 AAGAATGGCTGGCTGAAGCTGGG + Intronic
916567199 1:165991368-165991390 TAAAATGCATAGCTGCAACTAGG + Intergenic
916599203 1:166276025-166276047 GACACTGCCTGTCTCCAGCTTGG + Intergenic
918094089 1:181320484-181320506 GAAAATGCCTGGAAGCTGCTTGG - Intergenic
920421022 1:205833617-205833639 AAAAATTCCTGGCTGCAGTCAGG + Intronic
921471673 1:215557303-215557325 GAAAATGCATGGCTGCCCTTCGG + Intergenic
922800403 1:228362348-228362370 GGAAGTGCCTGCCTGCAGCATGG + Intronic
1064957265 10:20924713-20924735 GAAAATGGCTGGAGGCAGTTTGG + Intronic
1066952015 10:42128717-42128739 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1067666644 10:48284978-48285000 GAGAAGGCATGGCTGCAGCCTGG - Intergenic
1072794841 10:98346803-98346825 GAGAATGCCTGGCTGAAGACGGG - Intergenic
1072900032 10:99399153-99399175 AAATCTGCATGGCTGCAGCTAGG + Intronic
1073376834 10:103042359-103042381 GGAAAGGCCTGGCAGCAGGTGGG - Intronic
1074574307 10:114654115-114654137 GAACATGCATGGCTGCAGGAGGG + Intronic
1074779095 10:116787781-116787803 GAGAGTGCCTGGCAGCCGCTTGG + Intergenic
1076019117 10:127055964-127055986 GACCATGCCTGGCTCCTGCTGGG - Intronic
1077074146 11:692555-692577 AAAAATGCCTGTTTGCAGCCGGG + Intronic
1080859723 11:36142728-36142750 GAAAATGCCTGGCTGCAGCTGGG - Intronic
1081717412 11:45260190-45260212 GCAAATGGCTGGCTTTAGCTGGG + Intronic
1081859266 11:46323118-46323140 GACAATACCTGGCTGCAGCCTGG + Intergenic
1083431524 11:62615831-62615853 CCAGAGGCCTGGCTGCAGCTGGG - Intronic
1083731405 11:64654328-64654350 GGAAATGCCAGGCTGCTACTGGG + Intronic
1083840524 11:65301800-65301822 CCAAATGCCTGAATGCAGCTGGG - Intronic
1084665871 11:70575923-70575945 GACACTGCCAGGCTGCAGCACGG - Intronic
1085625780 11:78071720-78071742 GGGAATGCCTGACTGTAGCTGGG + Intronic
1087368361 11:97249856-97249878 GAAAATGCTTGCCTGAAGGTAGG + Intergenic
1089302412 11:117506620-117506642 GAACATGGCTGACTGCAGCCTGG + Intronic
1090802757 11:130183411-130183433 AAAAATGTCTAGTTGCAGCTGGG + Intronic
1091108088 11:132941935-132941957 CAAAATGCCTGGCTTCCCCTAGG - Intronic
1091347639 11:134865967-134865989 GAAAATGCCTGCCTGGCTCTTGG + Intergenic
1091351709 11:134903157-134903179 GCTAATGCCTGGCTGCTGGTAGG + Intergenic
1091689684 12:2587469-2587491 GTACAGGCCTGGCTGCAGCTGGG - Intronic
1091901993 12:4151849-4151871 GCAAATGCATGCCTGCACCTGGG + Intergenic
1092223020 12:6728218-6728240 GAAGATTCCGGGCTTCAGCTAGG - Exonic
1099506352 12:83481225-83481247 GAATATGACTGGCTGCACTTGGG - Intergenic
1099883882 12:88502970-88502992 GAAAAAGCATGGTTTCAGCTTGG + Intronic
1101455710 12:104827984-104828006 AAAAATGCCTGTCTTCACCTAGG - Intronic
1101932867 12:109029161-109029183 GAAAGATACTGGCTGCAGCTTGG + Intronic
1102118537 12:110422350-110422372 AAAAATGTCTGATTGCAGCTGGG - Intergenic
1104117522 12:125764132-125764154 AAAAATGCCTGGCTGCAGCCAGG + Intergenic
1104598259 12:130134466-130134488 GAGAAGACCTAGCTGCAGCTGGG + Intergenic
1105232930 13:18516474-18516496 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1109164976 13:59022403-59022425 GAAGCTTCCTGCCTGCAGCTGGG - Intergenic
1109172937 13:59118290-59118312 AAAAATGCCTGTCTTCACCTAGG + Intergenic
1112579422 13:100665532-100665554 GAGACTGCCTGGCTGCCTCTGGG + Intronic
1112715760 13:102183069-102183091 GACATTGCCTGGCTGCAGGCAGG + Intronic
1113448448 13:110388259-110388281 GCAGCTGCCTGGCTGCGGCTGGG - Intronic
1114951385 14:27758995-27759017 GAAAAAGCTTGGCTTCAACTAGG - Intergenic
1115573969 14:34693295-34693317 GGAAATGCCTGACTACACCTTGG - Intergenic
1116849263 14:49892705-49892727 GAACAGGCCTGGAGGCAGCTCGG + Intergenic
1118255445 14:64201431-64201453 GAAACTGGCCGGCTGCAGCCTGG + Intronic
1119257695 14:73213117-73213139 GAAAGTCACAGGCTGCAGCTGGG - Intronic
1120075443 14:80151805-80151827 TAAAATGCCTGGCTGAACCTTGG - Intergenic
1121311640 14:92938619-92938641 GAACCTGCCAGGTTGCAGCTGGG + Exonic
1121698166 14:95929629-95929651 GAAACAGCCTGTCTGCATCTCGG - Intergenic
1122026756 14:98883435-98883457 GAAAGTGCATGGCTCCAGGTAGG - Intergenic
1122623238 14:103071460-103071482 GAACATTCCTGGCTGCAGTGGGG - Intergenic
1202938041 14_KI270725v1_random:111341-111363 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1125490916 15:40147776-40147798 GAACAGGCCTGGCTGGAGCTTGG - Intergenic
1127705362 15:61541631-61541653 GAAAATGCCAGGCTGGAAATAGG - Intergenic
1128137678 15:65276040-65276062 GAAGAGGCCTGGGTCCAGCTTGG - Intronic
1128508998 15:68302166-68302188 GCACCGGCCTGGCTGCAGCTGGG - Exonic
1133146135 16:3788057-3788079 GGAGATGCCGGGCAGCAGCTGGG + Intronic
1133717324 16:8462461-8462483 GAAAATCACTGTCTGCAGCATGG - Intergenic
1136044274 16:27602993-27603015 GAAAAGCCCTGGCATCAGCTGGG - Intronic
1136770102 16:32830157-32830179 GAATATGCCTTGATGCAGCCAGG + Intergenic
1136770103 16:32830164-32830186 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1136936219 16:34468085-34468107 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1136940260 16:34517920-34517942 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1136945505 16:34645868-34645890 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1136948431 16:34685015-34685037 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1136955830 16:34784889-34784911 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1136959560 16:34830649-34830671 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1136963601 16:34880485-34880507 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1136967744 16:34935016-34935038 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1137088232 16:36155771-36155793 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1137220456 16:46444590-46444612 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1137852423 16:51759444-51759466 CAAAATGTCTGGGTGCAGATAGG + Intergenic
1138308109 16:55997134-55997156 GAAGAGGCCTGGTTGGAGCTCGG + Intergenic
1139064085 16:63291316-63291338 AAAAATGCCTGTCTTCACCTAGG - Intergenic
1139537206 16:67584074-67584096 AAAAATGTCTGCCTTCAGCTGGG + Intronic
1140065673 16:71609342-71609364 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1140104823 16:71950176-71950198 GAAGTTGGCTGGCTGCATCTAGG + Exonic
1140882387 16:79210585-79210607 GAAAATTAGTGGATGCAGCTAGG + Intronic
1141183914 16:81773601-81773623 GCAAATGCCTGGTTGCAGTCTGG + Intronic
1142033501 16:87850100-87850122 GACAAAGTCTGGCTGCAGCTGGG - Intronic
1203072521 16_KI270728v1_random:1092264-1092286 GAATATGCCTTGATGCAGCCAGG + Intergenic
1203072522 16_KI270728v1_random:1092271-1092293 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1142564702 17:832478-832500 AAAAATTCCTGGCTGAGGCTGGG - Intronic
1142580337 17:938027-938049 GAAGAGGAATGGCTGCAGCTGGG + Intronic
1143271178 17:5675966-5675988 GAAAATTCCTTGCTGAAGATGGG + Intergenic
1143686821 17:8524004-8524026 GAAAATTCCAGTCTGCTGCTAGG + Intronic
1144132869 17:12265010-12265032 AAAATTGCCTGCCTGCACCTAGG - Intergenic
1144403193 17:14926558-14926580 GAAAATGCCTGCCTGCGGGGTGG - Intergenic
1145691775 17:26748952-26748974 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1145897067 17:28465292-28465314 GAAAATGCTTAGCTGGGGCTTGG + Intronic
1146829825 17:36058805-36058827 GAAAATGCCTGTGTGATGCTGGG + Intergenic
1148954657 17:51343703-51343725 AAAGATCCCTGGCTGCAGGTTGG - Intergenic
1148968829 17:51461739-51461761 GAGACTGCCAGGCTGGAGCTGGG + Intergenic
1150073110 17:62169288-62169310 GAAAATGTTTTGCTTCAGCTGGG - Intergenic
1152062290 17:78086702-78086724 GAAAATTCCTGGGTTCAGCTAGG + Intronic
1152498219 17:80689915-80689937 AAAAATGTCTGGCTGCACCTTGG + Intronic
1152689443 17:81711433-81711455 GGAGATGCCTGCCTGCATCTGGG - Intergenic
1203183295 17_KI270729v1_random:86497-86519 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1154520374 18:15221982-15222004 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1155187477 18:23399890-23399912 GCAAACGCCTTGCTGCAGCTTGG + Intronic
1158916900 18:62141672-62141694 GAATACCCCTGGCTGCAGCATGG - Intronic
1159739799 18:72153186-72153208 GAAAATGCCAGGCTGTGCCTGGG + Intergenic
1160532506 18:79573866-79573888 GAAAAAGCCTTGCTGAAGCAAGG + Intergenic
1160824649 19:1074026-1074048 TCAAATGCCTGCCTGCCGCTGGG - Intronic
1161291179 19:3494152-3494174 GAAAATGCCCGGCTACCTCTGGG + Intronic
1161771223 19:6231794-6231816 GAAATTGTCTTGCTTCAGCTGGG - Intronic
1161851108 19:6738593-6738615 GAAAATGTCTGATTGCAGTTGGG - Intronic
1164762325 19:30737345-30737367 CAAAATGCCTGGTTCCAGCCAGG + Intergenic
1165420230 19:35718570-35718592 GCGAGTGCCTGGCTGCAGCCGGG - Intronic
1166353991 19:42216620-42216642 GAAAGGGCCTGGCTCCCGCTGGG - Intronic
1166563942 19:43751972-43751994 GCAAATGCCTTGCTGCATTTTGG - Intronic
1168389228 19:55992736-55992758 AAAAATGCCTGGCTCCTTCTGGG + Intergenic
1202671409 1_KI270709v1_random:57043-57065 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1202681764 1_KI270712v1_random:11810-11832 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
925188321 2:1864425-1864447 GCACATGCCTAGCTGAAGCTGGG - Intronic
926652742 2:15364235-15364257 GAAAATGCCTTGAAGCAGCCGGG + Intronic
927151150 2:20196910-20196932 GCTAGGGCCTGGCTGCAGCTGGG + Intergenic
928637503 2:33262771-33262793 GGAAATGCCTGGAGACAGCTGGG - Exonic
929962170 2:46504985-46505007 GAAAGTGCGTGGCCACAGCTGGG - Intronic
930245734 2:48981563-48981585 GAGAATGCCTGGCTTGAGATAGG - Intronic
930472378 2:51834743-51834765 GAAGATGACTGAATGCAGCTTGG + Intergenic
932129621 2:69176021-69176043 GAAGATGCCTGACAGTAGCTTGG - Intronic
934250002 2:90343267-90343289 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
934259570 2:91460174-91460196 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
934302866 2:91792094-91792116 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
934330395 2:92060673-92060695 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
934468616 2:94290569-94290591 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
934485959 2:94710706-94710728 GAAAAAGCTTGGCTTCAACTAGG + Intergenic
935208078 2:100913962-100913984 CAAGATGCATGGCTGTAGCTGGG - Intronic
935244461 2:101206152-101206174 GAAACTTCCTGGGAGCAGCTGGG + Intronic
937032926 2:118755773-118755795 CAAAATCCCTGGCTGGGGCTTGG + Intergenic
938519731 2:132055757-132055779 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
939587228 2:144020223-144020245 GGAAATGCCTGTCTTCACCTAGG - Intronic
940004102 2:148995859-148995881 AAAAATGAATGGATGCAGCTGGG + Intronic
942161007 2:173187078-173187100 GAAAAAGCCAAGCTGCAGCCAGG + Intronic
942170478 2:173284728-173284750 GAAAATGCCTGGCTAGAATTAGG - Intergenic
945412484 2:209527802-209527824 AGAAATGTGTGGCTGCAGCTCGG + Intronic
945735723 2:213597880-213597902 GAGAAAGCCTGGCTGCATCAAGG - Intronic
945986513 2:216358803-216358825 ACAAATGCCTGGCTGCATCTAGG - Intronic
947237228 2:227953691-227953713 AAAAAATACTGGCTGCAGCTGGG - Intergenic
947719753 2:232363289-232363311 GAATGTGCCTGGCTGCAGCAGGG + Intergenic
948225328 2:236305343-236305365 GACCATGCCTGGGAGCAGCTAGG - Intergenic
1170116459 20:12865459-12865481 GACAATGACTGGAGGCAGCTTGG + Intergenic
1170271024 20:14527339-14527361 GAAAATGCCTGTCTTCACCTAGG + Intronic
1171373472 20:24676272-24676294 GAAGATGCCTGGCTGGACATGGG + Intergenic
1172752324 20:37259454-37259476 AAGAAAGCCAGGCTGCAGCTGGG - Intronic
1176585275 21:8577795-8577817 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1176776907 21:13144776-13144798 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1178184998 21:30208929-30208951 GAAGATGCGTGGGTGCAGCCAGG + Intergenic
1180268084 22:10554694-10554716 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1180524871 22:16248083-16248105 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1180799267 22:18624231-18624253 GCCAATGCATGGCAGCAGCTGGG + Intergenic
1180892136 22:19297035-19297057 GAAAATGCCTGTCCTCACCTAGG + Intergenic
1181222451 22:21371035-21371057 GCCAATGCATGGCAGCAGCTGGG - Intergenic
1181638207 22:24184021-24184043 GCCAATGCATGGCAGCAGCTGGG - Intronic
1203237117 22_KI270732v1_random:14990-15012 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1203323485 22_KI270737v1_random:92764-92786 GAGAAAGCCTGGCTGCATCGAGG - Intergenic
949959776 3:9302428-9302450 TGTCATGCCTGGCTGCAGCTGGG - Intronic
950264003 3:11561546-11561568 CAAGATGCCTGACTCCAGCTGGG - Intronic
950880366 3:16318035-16318057 GGAAATGCTTGGTTGCAGGTTGG - Intronic
952315378 3:32227789-32227811 GAAAGTGCCTGAGTGCAGCGGGG - Intergenic
952836645 3:37608034-37608056 AAAAAGCCCTGGCTGCAGATCGG - Intronic
953908202 3:46878904-46878926 GAAAAGGCCTGGCTGGGGGTGGG - Intronic
954660195 3:52222964-52222986 GAGAAGGTCTGGCTGCAGCCTGG - Exonic
954848511 3:53580412-53580434 GAAAGTGCCTGGCAGATGCTTGG + Intronic
955076834 3:55621747-55621769 GAAAATGCCAGGAGACAGCTAGG + Intronic
956440008 3:69270857-69270879 GAAAATGCTTGGTTGGGGCTGGG - Intronic
959369444 3:105504787-105504809 AAAAATGCCTGTCTTCACCTAGG + Intronic
961181663 3:124882778-124882800 GAAAATGTCTGGCTGGAGTTGGG + Intronic
963229277 3:142893561-142893583 GATCATGGCTCGCTGCAGCTGGG + Intergenic
963927063 3:150961769-150961791 CATAATGACTGGCTGCAGATGGG - Intronic
967051629 3:185790027-185790049 TAAGATTCCTGGTTGCAGCTGGG - Intronic
968642213 4:1720518-1720540 GAAAGCGCCTGGGCGCAGCTGGG - Intronic
969141383 4:5077303-5077325 GGAAATGCCTGCGTGCAGCAAGG - Intronic
969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG + Intronic
973641211 4:52904740-52904762 GAAAATGCCTGGCAGCCTCCTGG + Intronic
980212195 4:129803778-129803800 GAAAAAAGCTGTCTGCAGCTTGG - Intergenic
980716440 4:136636163-136636185 AAAAATGCCTGTCCTCAGCTAGG - Intergenic
983316010 4:166134005-166134027 GAAACAGCCTGGCTGCCCCTTGG + Intergenic
983563772 4:169128345-169128367 GAAGATGCCTGGATTCATCTGGG - Intronic
984261197 4:177445029-177445051 AAAAATGCCTGTCTTCACCTAGG - Intergenic
985781874 5:1875843-1875865 GAAAATGCCTGGCTTTGTCTAGG + Intergenic
985809563 5:2073157-2073179 GAGAATGCCTGGGTGCTGCAGGG + Intergenic
987057711 5:14210408-14210430 CAAAATGGCTGGCTGCAAATAGG - Intronic
987838010 5:23186524-23186546 CAAACTGCCAGGCTGCAGCCTGG + Intergenic
989110863 5:37905550-37905572 AAAAATGTCTGGCTGCAGTGTGG - Intergenic
992114131 5:73523223-73523245 GAAACTGCGTGGCTGCTCCTTGG - Intergenic
993306785 5:86284220-86284242 GGAAATGCCTGCCTGGAGCCTGG + Intergenic
998116390 5:139541000-139541022 AAAAAAGTCTGGATGCAGCTGGG + Intronic
1000699655 5:164433083-164433105 GAAAATGCCAGGATGCTGCTTGG + Intergenic
1003181771 6:3798353-3798375 GTAAACCCCAGGCTGCAGCTGGG - Intergenic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1004535365 6:16495525-16495547 AAAATTGCATGGCTACAGCTGGG + Intronic
1007619792 6:43204937-43204959 GCAGATTCCTGGCTGCAGCTTGG + Exonic
1010493972 6:76510632-76510654 CAAAATGCCTGGCAGTAGTTAGG + Intergenic
1011791310 6:90902101-90902123 CAAGATGACTGGCTGCAGCTAGG + Intergenic
1012001154 6:93656706-93656728 GAAGCAGCATGGCTGCAGCTGGG - Intergenic
1013318071 6:108960336-108960358 GAAGAGGCAGGGCTGCAGCTGGG - Intronic
1014898415 6:126932409-126932431 GCAAATGCCTGGCTCCAGGCAGG - Intergenic
1015958525 6:138623021-138623043 GAACATGCCTGGCTGTTGCAGGG - Intronic
1016598170 6:145825033-145825055 GCAAATGCCTGTCTGAAGCCAGG + Intergenic
1017507350 6:155080726-155080748 GAAGATGCCACGTTGCAGCTGGG - Intronic
1019573952 7:1727235-1727257 GGAGAGGCCTGGCTGAAGCTTGG - Intronic
1024817956 7:53293577-53293599 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1025474061 7:60897568-60897590 GATAAAGCCTGGCTGCATCAAGG + Intergenic
1025488694 7:61084126-61084148 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1025512941 7:61592306-61592328 GATAAAGCCTGGCTGCATCAAGG - Intergenic
1025551742 7:62258632-62258654 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1025885750 7:65589745-65589767 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1026977281 7:74506470-74506492 GAAACTCCCTGTCTGCAGGTAGG + Intronic
1028749748 7:94369692-94369714 GAAAAAGCCAGGCCCCAGCTAGG + Intergenic
1029189418 7:98761137-98761159 GAAGATCCCAGGCTGCATCTGGG - Intergenic
1029346278 7:99980920-99980942 GAGAAGGGCTGGATGCAGCTGGG + Intergenic
1029558896 7:101289595-101289617 GAGAAGGGCTGGATGCAGCTGGG - Intergenic
1030101748 7:105952911-105952933 AAAAATGCCTGTCTTCACCTAGG - Intronic
1030738550 7:113080691-113080713 TGAGATGCCTGGCTGAAGCTAGG - Exonic
1032195372 7:129785638-129785660 GAGAATGCCCGGCTCCAGCCCGG + Intergenic
1032341635 7:131079360-131079382 AAAAATGCCTGGCAGCAGTGTGG - Intergenic
1034751579 7:153573905-153573927 GACAATGCAAGGCTGCAGCAGGG - Intergenic
1035261454 7:157664099-157664121 GAAAGTGACTGGCTACAGCGGGG + Intronic
1036418591 8:8574253-8574275 GAGAATGCCTGAATGTAGCTGGG + Intergenic
1037408188 8:18566041-18566063 GAAGATGTCTGGCTGCCCCTAGG - Intronic
1038326894 8:26578623-26578645 GAATATGCATGCCTGGAGCTCGG + Intronic
1039288272 8:36066464-36066486 GTAAGTGTCTGGCTGCTGCTAGG - Intergenic
1040578431 8:48674903-48674925 AAAAATTCCAGGCTACAGCTTGG + Intergenic
1041766986 8:61429124-61429146 AAAAAAGCCTGCCTGCAGCTGGG + Intronic
1042124166 8:65520609-65520631 GAGAATACCTGTCTGTAGCTTGG - Intergenic
1042946832 8:74163676-74163698 GAAAATGCCTGTCTAAAGCAAGG - Intergenic
1044255234 8:90052411-90052433 TAAAATGCCTGGCTACAAATAGG - Intergenic
1044882264 8:96735713-96735735 GTAAAGGCCTGTCTGCAGATGGG - Intronic
1047206586 8:122807147-122807169 GACAATGCCTGGCTCCTACTGGG + Intronic
1047678389 8:127227680-127227702 GAAAATCTCAGGCTTCAGCTAGG + Intergenic
1048252165 8:132875827-132875849 GAAAATCCCTGATTACAGCTGGG - Intronic
1049253301 8:141600817-141600839 GAGGGTGCCTGGCTGCAGCCAGG - Intergenic
1051144008 9:14007490-14007512 AAAAATGCCTGTCTTCACCTAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053415492 9:37944621-37944643 GAAAATGCCTCGCAGGACCTTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053577109 9:39364198-39364220 GGCCATGCCTGGCTGCTGCTGGG + Intergenic
1053671830 9:40373618-40373640 GAAAAAGCTTGGCTTCAACTAGG - Intergenic
1053699013 9:40668593-40668615 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1053841614 9:42192123-42192145 GGCCATGCCTGGCTGCTGCTGGG + Intergenic
1053921642 9:42999980-43000002 GAAAAAGCTTGGCTTCAACTAGG - Intergenic
1053945020 9:43298834-43298856 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1054098680 9:60922888-60922910 GGCCATGCCTGGCTGCTGCTGGG + Intergenic
1054120080 9:61198517-61198539 GGCCATGCCTGGCTGCTGCTGGG + Intergenic
1054310302 9:63467994-63468016 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1054382944 9:64513666-64513688 GAAAAAGCTTGGCTTCAACTAGG - Intergenic
1054409091 9:64792143-64792165 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1054442251 9:65275960-65275982 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1054488030 9:65745537-65745559 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1054587676 9:66984045-66984067 GGCCATGCCTGGCTGCTGCTGGG - Intergenic
1055723777 9:79205203-79205225 GAAAATATGTGGCAGCAGCTAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057951896 9:99375888-99375910 GACAATGCCTGGCCTCAGATTGG - Intergenic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1058871090 9:109202230-109202252 GAAAAGCCCTGGAGGCAGCTGGG + Intronic
1059419368 9:114181431-114181453 GAATGTGACAGGCTGCAGCTGGG + Intronic
1060044316 9:120327765-120327787 GAAAAGGCCTGCCTGCAGCCTGG + Intergenic
1060173277 9:121478993-121479015 AAAAACTCCAGGCTGCAGCTTGG + Intergenic
1062444790 9:136589042-136589064 CAAAATGCCTCCCAGCAGCTGGG - Intergenic
1203581150 Un_KI270746v1:6302-6324 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1203588155 Un_KI270747v1:27412-27434 GAGAAAGCCTGGCTGCATCAAGG - Intergenic
1203615179 Un_KI270749v1:55311-55333 GAGAAAGCCTGGCTGCATCAAGG + Intergenic
1187379256 X:18785592-18785614 TACCATGCCTGGCTGCAACTGGG - Intronic
1190597862 X:52065119-52065141 GATAAAGCCCGGCAGCAGCTTGG + Intronic
1190610962 X:52188954-52188976 GATAAAGCCCGGCAGCAGCTTGG - Intronic
1191235503 X:58130703-58130725 TAAAATGCCTGGCTTCGGCCAGG - Intergenic
1193183674 X:78487202-78487224 GAAAATGCCTGTCCTCACCTAGG + Intergenic
1197334580 X:125196921-125196943 TAAAATGTCTGTATGCAGCTGGG + Intergenic
1197730626 X:129806219-129806241 GAAAATGCCAGTGTGCAACTGGG + Exonic
1198441604 X:136668666-136668688 GAGATTACCTGGCAGCAGCTTGG + Intronic
1199965032 X:152812550-152812572 GAAGATACCTGGCTGCCTCTGGG - Intergenic
1201365664 Y:13204233-13204255 GAAGAGGCCTGGCAGCAGCAAGG - Intergenic