ID: 1080859789

View in Genome Browser
Species Human (GRCh38)
Location 11:36143255-36143277
Sequence ACTTTTAAGCAGGGGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080859789_1080859799 18 Left 1080859789 11:36143255-36143277 CCTTGCTTCCCCTGCTTAAAAGT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1080859799 11:36143296-36143318 CAGAAAGGAAACCCAAGGCCTGG 0: 1
1: 0
2: 1
3: 58
4: 535
1080859789_1080859797 13 Left 1080859789 11:36143255-36143277 CCTTGCTTCCCCTGCTTAAAAGT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1080859797 11:36143291-36143313 CTGGCCAGAAAGGAAACCCAAGG 0: 1
1: 0
2: 2
3: 28
4: 258
1080859789_1080859794 3 Left 1080859789 11:36143255-36143277 CCTTGCTTCCCCTGCTTAAAAGT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1080859794 11:36143281-36143303 AAAGAACTCCCTGGCCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 366
1080859789_1080859793 -6 Left 1080859789 11:36143255-36143277 CCTTGCTTCCCCTGCTTAAAAGT 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1080859793 11:36143272-36143294 AAAAGTCACAAAGAACTCCCTGG 0: 1
1: 0
2: 2
3: 26
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080859789 Original CRISPR ACTTTTAAGCAGGGGAAGCA AGG (reversed) Intronic
900183448 1:1322526-1322548 ACTTTTGAGCAGGGGAGGGGAGG + Intronic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
904285780 1:29452507-29452529 ACTTTGAAGGATGGGGAGCAGGG + Intergenic
906865087 1:49409421-49409443 ACTTTTGGGGAGGGGAAGGAAGG + Intronic
907092822 1:51744697-51744719 ACTGTTAAGCAGGGGACTGAGGG - Intronic
907327663 1:53651254-53651276 ACTATTAAGTAAGGGAAACAAGG + Intronic
908678935 1:66637190-66637212 ACTTTCAAGAAGAAGAAGCAAGG - Intronic
909562139 1:77018878-77018900 CCTGTTAAGCAGGAAAAGCAAGG + Intronic
910075898 1:83278440-83278462 ATTTGTAAGCAGGGTAACCATGG - Intergenic
910303907 1:85740013-85740035 ATTTTTAAGCTGGGTAAGAAGGG - Intronic
912565797 1:110586355-110586377 ACTTTTATGCAGGGTGGGCAGGG - Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914336867 1:146723219-146723241 TCTTTTAAGAAGGGAAAACACGG - Intergenic
914338443 1:146738175-146738197 CCTCTGAAGCAGGGAAAGCAGGG + Intergenic
915491814 1:156254296-156254318 ACTTTTAAGCAGGGCTATAATGG - Intronic
917091279 1:171355893-171355915 ACTTATAAGCGGGAAAAGCAAGG - Intergenic
917435060 1:175012519-175012541 AATTGTTAGCAGGGGAAGGAAGG + Intronic
917695436 1:177518269-177518291 AGTTTTAATCATGGGAAACATGG - Intergenic
920309478 1:205040348-205040370 ACTTTCAAACAGGGCAAGAAAGG - Intergenic
921222225 1:212981308-212981330 GCTTTCCATCAGGGGAAGCAAGG + Intronic
923389063 1:233495730-233495752 ACTTTCCAGCAGAGGAAGAATGG - Intergenic
924048426 1:240055789-240055811 CTTTTTAAGCAAGGGAAGCCAGG + Intronic
924947610 1:248856792-248856814 ACTTTTAAGAAGGAGGAGGAGGG + Intronic
1064560274 10:16588826-16588848 AATTTAAAGCAGGGTAATCAGGG + Intergenic
1064665923 10:17651127-17651149 ACTTTTCAGCAGGGCATGTAAGG + Intronic
1065111827 10:22447945-22447967 GCTTGTAAGCAGGGGGAGCAGGG + Intronic
1065856856 10:29838317-29838339 ACTTTTTAGCATAGGAGGCAGGG + Intergenic
1069488574 10:68842119-68842141 ACTTTGGAGCAAGGCAAGCATGG - Intronic
1069620865 10:69836504-69836526 ACATATAAGCAGGGGAGGGAGGG + Intronic
1069907628 10:71741012-71741034 ACATTTAAACAGGGGCTGCATGG - Intronic
1071137275 10:82466948-82466970 ATTTTTAAGCAGGCGAAGGCGGG + Intronic
1071437479 10:85660673-85660695 CCTCTTAAGCAGAGGAAACAAGG + Intronic
1072306097 10:94108645-94108667 AGATATCAGCAGGGGAAGCAGGG - Intronic
1072409135 10:95184128-95184150 ACTTTGAAGATGAGGAAGCAGGG + Intergenic
1072893473 10:99345610-99345632 ATTTTTAAGCAGGGGATTCTGGG + Intronic
1074571318 10:114626830-114626852 CCTTTTAAAAAGGGGAAACATGG + Intronic
1075394629 10:122118096-122118118 AGTTTGAACCCGGGGAAGCAGGG - Intronic
1076757455 10:132579897-132579919 ACTTTTAAACAGGCAAGGCATGG - Intronic
1078508623 11:11969291-11969313 GCTTTACAGCAGGGGAAGGAGGG + Intronic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1082678709 11:56143102-56143124 ACTTTTAATCTTGGTAAGCATGG - Intergenic
1083159943 11:60848603-60848625 ACTTTTAAGCGGGGGGAAGAGGG + Intronic
1083210422 11:61181257-61181279 TTTTTTAAGTAGGGGGAGCATGG + Intergenic
1083268674 11:61559501-61559523 GCTTTTGAGCAGGGGAAGGATGG + Intronic
1084277495 11:68061683-68061705 TCTCTGAAGCAGGGGAGGCAAGG + Intronic
1088359543 11:108976388-108976410 ATTTTTAAACTGGGGAGGCATGG - Intergenic
1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG + Intergenic
1091059215 11:132445795-132445817 ACTTCTCAGCAGAGGAAGCCTGG - Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092876366 12:12851623-12851645 ACTTTTAGGCAAGGGAATGAAGG + Intergenic
1095377354 12:41546186-41546208 ACTGCTCAGCTGGGGAAGCAGGG + Intronic
1097956752 12:65494736-65494758 CCTTTTACTCAGGGGGAGCAGGG + Intergenic
1098624371 12:72644528-72644550 ACGTTGAAGCACTGGAAGCATGG - Intronic
1100415186 12:94365149-94365171 ATTTTTAAGCAAGGGAAAAAAGG + Intronic
1101192425 12:102348824-102348846 ACTTTTAAGTTGGGGAACCTGGG + Intergenic
1105216153 13:18286897-18286919 TCTTTAAAACAGGGGTAGCAGGG + Intergenic
1106593946 13:31121301-31121323 TGCTTTAAGCAGGGGAAGCAGGG + Intergenic
1111721798 13:91955750-91955772 AATTTTAAGCAGCTGCAGCATGG + Intronic
1113670161 13:112170779-112170801 CCTTGTAAGAAGGGGAAGCCTGG + Intergenic
1115366458 14:32563015-32563037 ACTTTTATACAAGGGAAACATGG + Intronic
1118406506 14:65429571-65429593 ACTTTAAAGCAGGCCAGGCATGG + Intronic
1118935681 14:70285696-70285718 CCTTTTTAGCAGGGGATGCCAGG - Intergenic
1119856527 14:77905132-77905154 AGATTTAAGCAGCAGAAGCAAGG + Intronic
1121784897 14:96649945-96649967 AGTTTTAAGCAGTTGCAGCAGGG - Intergenic
1126176226 15:45738173-45738195 ACTCTGAGGCAGGGAAAGCAAGG + Intergenic
1126724525 15:51618136-51618158 ACTTTTGGCCAGGGGAATCAAGG - Intronic
1126992901 15:54403424-54403446 ACTTTTAAAAAGTGGAAGCCAGG + Intronic
1129514118 15:76146442-76146464 ACTCCTAGGCAGGGGAAGCTTGG + Intronic
1130046504 15:80449909-80449931 ACTTTTACCCAGGGGAAGAAGGG - Intronic
1130087980 15:80794709-80794731 GCTATTAAGCACGGGAAACATGG - Intronic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131935929 15:97504939-97504961 ACTTATAAACTGTGGAAGCAGGG - Intergenic
1136562286 16:31047093-31047115 GGTGTTAGGCAGGGGAAGCAGGG - Intergenic
1137865537 16:51892245-51892267 ATTTTTAAGCAAGAAAAGCAGGG + Intergenic
1137961680 16:52887612-52887634 ACATTTAAGCAGGGAAATGAAGG + Intergenic
1138868882 16:60856556-60856578 ACTTGAAAGCAGGAGAAGCCAGG + Intergenic
1141640376 16:85337614-85337636 ACTTTCAAGCAGGGAAACCGGGG + Intergenic
1145219762 17:21078566-21078588 TGTTTTAACCATGGGAAGCATGG - Intergenic
1145940905 17:28743135-28743157 ACTTTGGAGCAGGGCAAGCCAGG + Exonic
1146508638 17:33426882-33426904 ACTTTTAGGGAGGGGAATAAGGG + Intronic
1148592816 17:48829447-48829469 ACATTTAAACAGTGGAAGAAGGG + Intergenic
1149088104 17:52744123-52744145 ACCTTGAAGCAGGGGAGTCAAGG + Intergenic
1149624240 17:58068425-58068447 ACCTTTAAGCAGGCGAAGAGGGG + Intergenic
1152071879 17:78138133-78138155 GCTATTCAGCAGGGGCAGCAGGG - Exonic
1153066030 18:1046061-1046083 ACTTTTAAGGTGGGTAGGCAAGG + Intergenic
1155040187 18:22058774-22058796 AATTTAAAGCAGGCCAAGCATGG + Intergenic
1159539064 18:69752681-69752703 ACTAATAGGCAAGGGAAGCAGGG - Intronic
1161982088 19:7635216-7635238 AGTTTTGAGCAGGGGAAGGCGGG - Intronic
1162185608 19:8902334-8902356 TGTTTTAGGCAAGGGAAGCATGG - Intronic
1162295630 19:9811412-9811434 GCATTCAAGCAGGGGCAGCACGG + Exonic
1162937243 19:13987334-13987356 ACCTTTAGGCAGGGCAGGCAGGG + Intronic
1163184847 19:15630315-15630337 ACTACTAGACAGGGGAAGCAGGG - Intronic
1166876028 19:45897847-45897869 ACTTTTAAACAGTGGAAGCCAGG - Intronic
1167024940 19:46908889-46908911 ACCTTTAAGCAGGGATTGCATGG + Intergenic
1168050568 19:53826644-53826666 AGTTTTGAGCAGGGGAGGGATGG + Intergenic
928176681 2:29038770-29038792 ATTTTTGAGCAGGTGAAGCATGG + Intronic
931200550 2:60093302-60093324 CATTTTAGGCAGGGGAAGCATGG + Intergenic
932685766 2:73868341-73868363 ACTTTCTAGCAGTGGAATCATGG - Intronic
933374760 2:81465334-81465356 TCGTTTAAGCAGAGGCAGCATGG - Intergenic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934792165 2:97070564-97070586 AATTTGATGCAGGGGAAGGAAGG + Intergenic
934814455 2:97313145-97313167 AATTTGATGCAGGGGAAGGAAGG - Intergenic
934823238 2:97395338-97395360 AATTTGATGCAGGGGAAGGAAGG + Intergenic
937820226 2:126302381-126302403 ACTTCAAAGGTGGGGAAGCAGGG - Intergenic
938247083 2:129786073-129786095 ATTTTTTAGCAGTAGAAGCAAGG - Intergenic
938682871 2:133710104-133710126 ACTTTTAAGCTTGGTAAGGATGG + Intergenic
939781526 2:146456243-146456265 ACTTTTAAGCAGGGGAATTAAGG - Intergenic
940432466 2:153609469-153609491 ACTTTTAAGCAGAGAAATGATGG - Intergenic
944190243 2:196995237-196995259 ACCTTCATGCAGGGGAAGCCAGG + Intronic
945882152 2:215336658-215336680 ACTTCCAAGAAGGTGAAGCAGGG - Intronic
948135421 2:235632718-235632740 ACTGTTTAGCATGGGAAACACGG - Intronic
1168951509 20:1805110-1805132 ACCTTTGAGTAGGAGAAGCAGGG + Intergenic
1170385635 20:15813391-15813413 ACTTTTGAGCTAGGGAAGCAGGG + Intronic
1172119771 20:32591242-32591264 ACTTTTAAGAAGGGCAGTCAAGG - Intronic
1175115096 20:56676591-56676613 ACCTTCCCGCAGGGGAAGCATGG + Intergenic
1175165778 20:57043452-57043474 AGTTTTAAGCAGGGAGGGCAGGG - Intergenic
1178234109 21:30821876-30821898 GGTTTTAAGCAGGGGAGGGATGG + Intergenic
1178936244 21:36864489-36864511 ACTTTTAAGCAGGATTAGGATGG - Intronic
1179224835 21:39444408-39444430 ACTTTTAAACCGGGTCAGCAAGG - Intronic
1182075439 22:27492394-27492416 ACTTGTAGGCTGGGGTAGCATGG + Intergenic
1182635493 22:31723414-31723436 CCTTTTAAACAGGAGAACCAGGG - Intronic
949230594 3:1745397-1745419 AATTTTAAGTAGTGGAAGAATGG - Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
949862749 3:8521453-8521475 GCCTTTGAGAAGGGGAAGCATGG - Intronic
951938051 3:28044516-28044538 ACTTATAGGAAGGGGAAGGAGGG - Intergenic
952430105 3:33214784-33214806 AATTTTAAGCAAGGAAACCACGG + Intronic
955299638 3:57765049-57765071 ACTTTTAAAAAGAGGAAGAATGG + Intronic
956487646 3:69739563-69739585 ACTTTCCAGCAGTGGAAGGACGG + Exonic
958738480 3:98038832-98038854 TCTTTTATGCAGAGGAAGCTAGG + Intergenic
960244128 3:115380864-115380886 CACTTTAAGCAGGGGAACCAAGG - Intergenic
961577953 3:127853929-127853951 GCTTTAAAGGAGAGGAAGCACGG + Intergenic
966058575 3:175727756-175727778 AAATGTAAGCAGTGGAAGCAAGG + Intronic
966561591 3:181326536-181326558 ACATTTAAGCAAAGAAAGCATGG - Intergenic
967941452 3:194769413-194769435 ATTTCTAAGCAGGGGAAGCGCGG + Intergenic
968309681 3:197673238-197673260 ACTTTGAGGCAGAGGAATCAAGG + Intronic
968446785 4:656137-656159 GCTTTTAAGTAGGTAAAGCAGGG - Intronic
970041659 4:11805105-11805127 CCTATGAAGCAGGGGAAGAAAGG - Intergenic
971359495 4:25923675-25923697 CCTTTTGGGCAGGGGCAGCAAGG - Intronic
972488495 4:39564696-39564718 ACTTTTAAGCAGGGGGCTAAGGG + Intronic
972810844 4:42584233-42584255 ACCATAAAGTAGGGGAAGCAGGG + Intronic
975631284 4:76405241-76405263 ACTTTCAAGAAGGGAAAGAAAGG + Intronic
977018368 4:91724825-91724847 ACTTTTAAGCTGGGAATGGAAGG - Intergenic
977721683 4:100246408-100246430 ACTTTTAACCAAGGAAACCAGGG + Intergenic
977815744 4:101411738-101411760 ACTTTCAAGATGGTGAAGCAAGG - Intronic
978700113 4:111632796-111632818 TTTTTAAAGCAGGGGAAGGAGGG + Intergenic
979704173 4:123701306-123701328 ATTTTTAAGGAGGGGAAACAAGG - Intergenic
981163397 4:141526516-141526538 ACTTTTAAGACTTGGAAGCAGGG + Intergenic
982604823 4:157501356-157501378 AATTATAAGCAGGGAAATCAGGG + Intergenic
983629374 4:169834166-169834188 AATTTTCAGCAGAGGAGGCAGGG - Intergenic
984829225 4:183955738-183955760 ACTTTAAAGAAGCGGATGCAAGG - Intronic
987402677 5:17494035-17494057 ACTTTGAAGCAAGGAAGGCATGG + Intergenic
988079232 5:26394928-26394950 AATATTAACCAGAGGAAGCAAGG + Intergenic
988731043 5:33973159-33973181 ACTTTCGAGCAGAGGAAACAGGG + Intronic
989702720 5:44289577-44289599 ACCTTTTCGGAGGGGAAGCAAGG - Intergenic
992201127 5:74384905-74384927 AGTTTTAAGCAAAGGAAGAAAGG + Intergenic
995560834 5:113379780-113379802 ACTTTTGAGCAGAGAATGCATGG + Intronic
996083986 5:119285331-119285353 CATTTTAAGCATGGGAACCAGGG + Intronic
997386256 5:133475102-133475124 GCATTTAAGTATGGGAAGCAGGG + Intronic
999207933 5:149863429-149863451 GCTTCTAAGCAGGTGAGGCATGG - Intronic
999787442 5:154904577-154904599 GCTTGTACTCAGGGGAAGCAAGG + Exonic
1001566485 5:172702759-172702781 ACTTTTATGCAGGTCAGGCAAGG - Intergenic
1003028252 6:2578114-2578136 TTTTTTAATCAGGGGAAGCAAGG - Intergenic
1003989031 6:11467502-11467524 ACATGTAAGCATGGGAAACATGG - Intergenic
1004084460 6:12431334-12431356 ACTTTTAAGATGGGAAGGCAGGG - Intergenic
1004537656 6:16518373-16518395 AATTTTGAGCAGGGTTAGCAGGG + Intronic
1004576806 6:16904109-16904131 ACTTTTCAGCAGAGAAAGAAAGG + Intergenic
1008090987 6:47293715-47293737 AGTTTTAAGCAGAGGATGAAAGG - Intronic
1009660862 6:66609392-66609414 ATTTTGAAACAGAGGAAGCAAGG - Intergenic
1010850720 6:80773098-80773120 GCTTTGAAGCAGGGGAAACATGG + Intergenic
1014943274 6:127468381-127468403 ACCTTTAAGCAGGGAAGACATGG + Intronic
1014986134 6:128012692-128012714 ATTTTTAAGTAGTGGGAGCAAGG - Intronic
1016334526 6:142990236-142990258 ACTCTTAAGTAGGGCAAACATGG + Intergenic
1018162127 6:161055186-161055208 ACTTTTAAGCAGGGTTGGGAAGG - Intronic
1018480755 6:164187468-164187490 AATTTTAAGCAGGATAAGGAAGG - Intergenic
1022331724 7:29385559-29385581 ACTTTTAAGTAGGGGGATCTGGG + Intronic
1022397067 7:29998801-29998823 AGATATAAGCAGGGGAAGAAAGG - Intergenic
1024214934 7:47240590-47240612 CCATTTCAGCAGGGGAAACATGG - Intergenic
1027293616 7:76743308-76743330 ATTTGTAAGCAGGGTAACCATGG - Intergenic
1028440246 7:90851396-90851418 ACTTATTAGAAAGGGAAGCATGG + Intronic
1030348510 7:108457885-108457907 ACTTTCAAGTAGGGGGATCATGG - Intergenic
1030827658 7:114180520-114180542 ACATTTAAGCAGGGATATCAAGG - Intronic
1033203426 7:139394501-139394523 ACTTTAAAGAAGTGGAGGCAGGG + Intronic
1033777809 7:144632369-144632391 AGTTTTAAGTAGGGTAATCAGGG - Intronic
1036419952 8:8586200-8586222 AGTTTTGAGCAGAGGAATCATGG - Intergenic
1038055343 8:23852736-23852758 ACTTGAAAGCATGGGAAGGAAGG + Intronic
1038750280 8:30288315-30288337 ACTTACAAGCAAGGGAAGAAAGG + Intergenic
1039258692 8:35747008-35747030 ACCTTTAAGTAGGGGAGGCAAGG - Intronic
1039321520 8:36437018-36437040 ACTTTTAAGAAGGGAAATGAGGG + Intergenic
1039653459 8:39371427-39371449 AGTTTTAAACAAGGGATGCAGGG + Intergenic
1040806455 8:51402227-51402249 TCTTTTAAGGAGCGGAGGCAGGG + Intronic
1041533928 8:58904634-58904656 ACTCTTAAGCAGTAGCAGCAGGG + Intronic
1042266795 8:66916661-66916683 ACTTTTAAGCTGGTTAAGGAAGG + Intronic
1043114015 8:76225652-76225674 AGTTGTAAGCTTGGGAAGCATGG + Intergenic
1043393105 8:79810152-79810174 ACTTCTAAGCAAATGAAGCATGG + Intergenic
1044437157 8:92177663-92177685 ACTTTATAGCAAGGGAAGTATGG + Intergenic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1045716622 8:105054418-105054440 TCTTTTTAGCAAGGGAAGAAAGG + Intronic
1046732138 8:117737216-117737238 ACTATCAAGCAGGTGCAGCATGG + Intergenic
1046843069 8:118883012-118883034 ACTTGTAAGCAGAGGCAGAATGG + Intergenic
1048488558 8:134870795-134870817 ACTATGAAGGAGAGGAAGCAAGG + Intergenic
1048568491 8:135629516-135629538 ACTTAGAAGCAGGGTAAGCTCGG - Intronic
1050689913 9:8214828-8214850 ACTTTTATACAAGGGAAACATGG + Intergenic
1051355978 9:16240033-16240055 ACTTGTTGGCAGGAGAAGCAAGG - Intronic
1052765645 9:32637614-32637636 ATTTTTAAGCAAGAAAAGCAAGG - Intergenic
1053342791 9:37352346-37352368 ACTCTCTAGCTGGGGAAGCAAGG + Intronic
1055274286 9:74596720-74596742 ACCAATAAGCAGGGGAAGCATGG - Intronic
1057739032 9:97695884-97695906 ACTTTTGATCATGGAAAGCAAGG - Intronic
1059460001 9:114423620-114423642 ACAGTTAAGGAGGGGAGGCAGGG - Intronic
1186026465 X:5319143-5319165 TGATTTAAGCATGGGAAGCAAGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1187386392 X:18852503-18852525 ACTTTCAGGCAGGGGCAGCTTGG - Intergenic
1191867106 X:65712940-65712962 GCTATTAAGCAGGGGAGACAGGG - Intronic
1194074296 X:89369348-89369370 GCTTCTAAGAAGTGGAAGCAAGG + Intergenic
1195893656 X:109723488-109723510 GCTGTTAAGCAGGGGAAGAGAGG - Intronic
1199870450 X:151893762-151893784 ACTTCTTAGCAGGGTAACCAAGG + Intergenic
1200729689 Y:6720875-6720897 GCTTCTAAGAAGTGGAAGCAAGG + Intergenic