ID: 1080864401

View in Genome Browser
Species Human (GRCh38)
Location 11:36180544-36180566
Sequence CCAGACAGTGAAGCCTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080864394_1080864401 29 Left 1080864394 11:36180492-36180514 CCTGCGAGGAGAGTGGCGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080864401 Original CRISPR CCAGACAGTGAAGCCTTATG AGG Intronic
902820645 1:18941289-18941311 CCAAACAGAGAAGCCTTGGGAGG - Intronic
903583788 1:24392654-24392676 CCACATAGTGAGGCCTTCTGAGG - Intronic
905205801 1:36342253-36342275 CCAGACAGCTAAGGCTTCTGAGG - Intronic
908262091 1:62347076-62347098 CCAGACAGGGAATGCTTGTGTGG - Intergenic
911370199 1:96987166-96987188 GCCGACAGTGCAGCCTTCTGTGG - Intergenic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
915873407 1:159586578-159586600 CCAGGTTGTGAAGCCTTATCTGG - Intergenic
916160636 1:161909380-161909402 CCAGACCGTGTAGCCTTATTTGG + Intronic
918136460 1:181678383-181678405 CCAGACAGTGGTGCCTTTTCAGG - Intronic
919097265 1:193052864-193052886 CCAGACTTTGAAACCTGATGTGG - Intronic
923767148 1:236902556-236902578 GCAGACTGTAAAGCCTCATGAGG + Exonic
924637055 1:245798336-245798358 GCAGACTGAGAAGCCTTCTGAGG + Intronic
1063168626 10:3486224-3486246 GCAGACAATAAACCCTTATGAGG - Intergenic
1063559772 10:7115111-7115133 CCAGAGAATGGAGCATTATGGGG - Intergenic
1063643007 10:7850092-7850114 CCAGACAGAGAGGACTTATCAGG - Intronic
1068946878 10:62738583-62738605 CCATACAGTGCAGCCTCATGGGG + Intergenic
1069673227 10:70228208-70228230 TCAGACACTGAAGCCTTATAAGG - Intronic
1071307401 10:84311271-84311293 TCAGACAGTGGACCCTTCTGAGG - Intergenic
1071678118 10:87676010-87676032 CCAGCCAGTGCAGTCTTCTGTGG + Intronic
1071853769 10:89602438-89602460 CCAGATGGTGAAGACTTTTGAGG - Intronic
1072606745 10:96990440-96990462 CCAGACTGGGAAGTCTTTTGAGG + Intergenic
1075580166 10:123611585-123611607 CCATACAGAGACACCTTATGTGG - Intergenic
1076560907 10:131362911-131362933 CAAGACAGAGAAGCCATCTGGGG - Intergenic
1080576079 11:33600433-33600455 ATGGACAGTGAAGCCATATGGGG + Intronic
1080809430 11:35688295-35688317 CCAGACACTGAAGCCTATTGGGG + Intronic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1083896733 11:65623925-65623947 CCAGAGCGTGCAGCCTGATGCGG + Exonic
1086375908 11:86200455-86200477 CTAGACAGAGGAGCCTTGTGGGG + Intergenic
1088392852 11:109334593-109334615 CCTGTGAGTGTAGCCTTATGTGG + Intergenic
1090257424 11:125295056-125295078 CCAGACAGTGAAGCTAGAGGCGG + Intronic
1090601186 11:128373542-128373564 CAAGACAGTGAAACATTATTTGG - Intergenic
1092561907 12:9624170-9624192 CAAGACAGAGAAGACTTGTGCGG - Intergenic
1092911976 12:13153529-13153551 GGACACAGTGATGCCTTATGTGG + Intergenic
1096939251 12:55324254-55324276 CCAGAAAGTGAAAGCTTATTTGG - Intergenic
1102188995 12:110971765-110971787 CCAGGCAGTGAAGGCTTCTTTGG + Intergenic
1108519978 13:51237939-51237961 CCAGGCATTGAAGCTTTCTGTGG + Intronic
1112709488 13:102111093-102111115 ACTGACAGTGAGGCATTATGGGG - Intronic
1113412735 13:110104817-110104839 CCAGGCAGAGAAGCCTGAGGTGG - Intergenic
1113418670 13:110152609-110152631 CCACACACTGCAGCCTCATGTGG + Intronic
1119709906 14:76814125-76814147 CCAGTCAGTAAAGGCTTATGTGG - Intronic
1121753145 14:96375996-96376018 CCAAAAAGTGAAGCCTTAAGAGG - Intronic
1125825475 15:42672763-42672785 GCTGACAGTGAAGCCTAGTGGGG + Intronic
1126015235 15:44344386-44344408 CCATACAGTGAACCCTTACTGGG + Intronic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1126476118 15:49066924-49066946 CCAGACATTGAAAGCTTATAAGG + Intergenic
1130950395 15:88581987-88582009 CCAGAAAGTGAAGCCTAACAGGG - Intergenic
1132463836 16:68535-68557 CCAGGCAGTGAGGCCTTCCGTGG - Intronic
1132886826 16:2185834-2185856 CCAGGCTGTGAAGCCCCATGTGG - Intronic
1137042112 16:35622575-35622597 CAAGACAATGAAGCCTAATATGG - Intergenic
1140222515 16:73054187-73054209 CCAGACAGTGTTGTCTAATGAGG + Intronic
1141692857 16:85606439-85606461 CCAGACAGTGCAGCTGTGTGAGG - Intergenic
1141743864 16:85913118-85913140 CCTGACTGTGCAGCCTTCTGTGG + Exonic
1142324851 16:89408149-89408171 CCACATAGTGCAGCCTTCTGGGG - Intronic
1144824593 17:18098672-18098694 CAAGGCAGTGAAGCTTCATGGGG - Intronic
1146919105 17:36698137-36698159 CCAGACTATGAAGCCTTGGGTGG + Intergenic
1146990684 17:37268650-37268672 CAAGACAGTGAAGAATTATGGGG - Intronic
1147014291 17:37478326-37478348 GCAGACAGTGCAGCGTGATGGGG - Exonic
1147162111 17:38574321-38574343 ACGGACACTGAAGCCTGATGAGG + Intronic
1148806648 17:50267191-50267213 CCAGGCAGGGAAGGCTGATGGGG + Intergenic
1149355564 17:55835716-55835738 CCAGACAGGAGAGCCTGATGGGG - Intronic
1150661852 17:67087944-67087966 CCAGACAGTCTAGCCTTAGATGG - Intronic
1160134512 18:76261142-76261164 CCATACAGTACAGCCTTGTGTGG + Intergenic
1160665161 19:324759-324781 CCAGACAGGGCACCCTCATGGGG + Intronic
1163570740 19:18080856-18080878 CCAGACAGAGAAGTCTCCTGAGG - Exonic
1165171956 19:33899580-33899602 CCAGACAGTGAGGACTTGAGAGG - Intergenic
1165483636 19:36081929-36081951 CCACACAGTGAGGCCTCACGGGG + Intronic
926514265 2:13821618-13821640 CCACACACTGAAGGCTTATTTGG + Intergenic
928100734 2:28436185-28436207 CCTCACAGAGAGGCCTTATGTGG - Intergenic
931345672 2:61443773-61443795 CCCAACAGTGAACCCTAATGTGG + Intronic
936921921 2:117697438-117697460 CCAGAGAGAGAAGCCTCCTGAGG - Intergenic
937589246 2:123593711-123593733 TCAGAAAGTGTAGCATTATGGGG + Intergenic
937657463 2:124392918-124392940 ACAGACAATGAAGTCTGATGTGG + Intronic
940038412 2:149332767-149332789 GCAGACAGCAAAGCCTTTTGGGG - Intronic
945413985 2:209548006-209548028 TCAAACAGTGAAGCTTTATATGG + Intronic
1171480575 20:25452966-25452988 CCAGCGAGTGAAGCCTTTTCTGG + Exonic
1173465463 20:43277528-43277550 CCAAACAGTGAAGCATTAGAAGG + Intergenic
1174072355 20:47908268-47908290 TCAGCCAGTGAAGCCATGTGTGG - Intergenic
1174151708 20:48490430-48490452 TCAGCCAGTGAAGCCATGTGTGG + Intergenic
1178499856 21:33116803-33116825 CAGAACAGTGGAGCCTTATGGGG - Intergenic
1181386912 22:22552993-22553015 CCAGCCAGTGAATCCTGATGGGG + Intronic
1181872557 22:25911501-25911523 CTGGAGAGTGGAGCCTTATGGGG + Intronic
1182002080 22:26927809-26927831 CCCGACAGAGAGGCGTTATGGGG + Intergenic
1183139488 22:35923285-35923307 CCAGTCAGCAGAGCCTTATGGGG + Intronic
1184956795 22:47893140-47893162 CGAGGCAGAGAAGCATTATGGGG + Intergenic
951809094 3:26679732-26679754 CCAGAATGTGGAGCTTTATGAGG + Intronic
953918223 3:46934302-46934324 CCACTCAGGGCAGCCTTATGGGG - Intronic
956376597 3:68620083-68620105 CCAGACAATGGAGCCATATTGGG - Intergenic
956456308 3:69423778-69423800 CCAGAAAGTGGACCCTTATCAGG + Intronic
968669092 4:1838822-1838844 TCAGAGAGTGCAGCCCTATGTGG - Intronic
969538370 4:7770435-7770457 CCAGAAAGTGAAGCTGTAGGAGG + Intronic
971773802 4:30933339-30933361 CCACACACTGAGGCCTGATGAGG + Intronic
971990952 4:33892942-33892964 CCAGACAATGAAGACCTATGAGG + Intergenic
977361156 4:96007632-96007654 CTAGAAAGTTAAGTCTTATGAGG + Intergenic
982387089 4:154819491-154819513 CAAGACAGTGACGAATTATGGGG - Intronic
982523879 4:156453341-156453363 CCAGAAAATGTAGCTTTATGAGG + Intergenic
982574804 4:157096186-157096208 CCAGACAGGGAAGCCTGCCGAGG - Intronic
985915458 5:2915065-2915087 CCAGAGCGTGAAGACTTCTGTGG + Intergenic
987799607 5:22676705-22676727 CCACACTGTGAATACTTATGTGG - Intronic
989514134 5:42322109-42322131 CCAGACATTGGAGAATTATGTGG + Intergenic
991049818 5:62260850-62260872 CCATGCACTTAAGCCTTATGGGG - Intergenic
996121693 5:119680521-119680543 CCCGGCAGAGAAGCCTGATGAGG - Intergenic
997383188 5:133451962-133451984 CCTGACAGGGAAGCATTAGGAGG - Intronic
999427821 5:151502883-151502905 CCAGACAGTGGAGTATTATTCGG + Intergenic
1000688723 5:164287710-164287732 CCAGACTGTGAAGCCATCTTAGG - Intergenic
1002144830 5:177171522-177171544 CCATACAATGAAGTATTATGTGG - Intronic
1002544222 5:179928040-179928062 CCAGACAGTGGAACATGATGCGG - Intronic
1004292056 6:14376446-14376468 ATAGACCGTGAAGCCTTCTGAGG - Intergenic
1007610336 6:43145035-43145057 GCAGACACTGAAGCCTAAGGAGG + Intronic
1007635850 6:43299296-43299318 CCAGACCCTGGAGCCTTCTGAGG - Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1008562616 6:52737132-52737154 GCAGACAGTGCAGCCTTCAGTGG - Intergenic
1011027953 6:82890096-82890118 CCAGACAGAGGAGGCTAATGTGG + Intergenic
1012078937 6:94730205-94730227 GCTGACAGTGAAGCGTCATGGGG + Intergenic
1014602333 6:123429161-123429183 AAAGACAGTGAAGCTTTATTTGG + Intronic
1014766344 6:125410842-125410864 CAAGACAGTTAAGCCTATTGTGG + Intergenic
1017200429 6:151747830-151747852 CCATACAATGAAGTCTTATTTGG - Intronic
1021940336 7:25672821-25672843 CCAGACAGGGCAGCCTTCTCTGG - Intergenic
1023295855 7:38714546-38714568 CCAGACAGTGAAGAATGATTCGG - Intergenic
1024440464 7:49410199-49410221 CCTGACAGTAAATTCTTATGGGG + Intergenic
1024982412 7:55168525-55168547 TCAGACAGTGAAGATTTATTAGG - Intronic
1035096535 7:156360485-156360507 CCAGGCAGTCAGGGCTTATGCGG + Intergenic
1035456478 7:159012786-159012808 CCACACAGTGAAGTTTAATGAGG + Intergenic
1038629213 8:29224890-29224912 ACAAACAGTGAGGACTTATGAGG + Intronic
1038634533 8:29274971-29274993 CCAGACAGTGAACACTTTGGGGG - Intergenic
1040186377 8:44642858-44642880 CTAGACAGAGAAGCATTCTGAGG + Intergenic
1041732843 8:61079639-61079661 CCAGACTGTGATGCTTTTTGAGG + Intronic
1042674500 8:71304914-71304936 CCATACACTGAAGCTTTCTGGGG - Intronic
1048807151 8:138251395-138251417 ACAGTCAGTGCAGCGTTATGAGG - Intronic
1052067077 9:24035137-24035159 GCAGACAGAGAAACCTTCTGAGG - Intergenic
1055461864 9:76527319-76527341 TCAGCCACTGAAGCCTTCTGTGG - Intergenic
1056743372 9:89279532-89279554 CCATACAATTAAGCCATATGAGG + Intergenic
1057139019 9:92715688-92715710 CCAGGCAGGGCAGCCCTATGAGG + Intronic
1060184208 9:121553986-121554008 CCAGACAGTGAAGATTTAAATGG + Intergenic
1061258055 9:129464212-129464234 CCAGACAGTGAACCCTGTGGAGG - Intergenic
1187485963 X:19703660-19703682 CCTGACAGATAAGCCTTAGGAGG - Intronic
1189329891 X:40137729-40137751 CCAGACAGTGGAGGTTTCTGGGG + Intronic
1190740866 X:53288027-53288049 CCAGACTGTGAAGCAGTAAGTGG + Intronic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1198160119 X:133999810-133999832 CCAGAGGGTGACGCCTTCTGTGG + Intergenic
1200756232 Y:6992493-6992515 CCTGAGAGTGAATCCTTATTGGG - Intronic