ID: 1080866101

View in Genome Browser
Species Human (GRCh38)
Location 11:36196580-36196602
Sequence GCATCATTCCAGGTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080866101_1080866106 0 Left 1080866101 11:36196580-36196602 CCTGCTTTAACCTGGAATGATGC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1080866106 11:36196603-36196625 CAGCATGTTGGGTTTTACCCTGG 0: 1
1: 0
2: 2
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080866101 Original CRISPR GCATCATTCCAGGTTAAAGC AGG (reversed) Intronic
900879219 1:5368543-5368565 GCATCACTCCAATTTATAGCTGG + Intergenic
904274288 1:29370170-29370192 GCTCCATTCCAGGTTCAAGTTGG + Intergenic
905204324 1:36334374-36334396 CCATCTTTCCAGGTTAAAAAGGG + Intergenic
908311942 1:62893168-62893190 GAATCATTCAGGGTTAAAACTGG + Intergenic
909204167 1:72731798-72731820 GCATTATGCCAGGTTACAGGAGG + Intergenic
909801936 1:79820908-79820930 GCATCATTCAAGGATTAATCAGG - Intergenic
910811647 1:91243218-91243240 GAATCAATCCAGGAGAAAGCTGG + Intergenic
911253273 1:95604801-95604823 GCTTCTTGCCAGGATAAAGCTGG - Intergenic
912513390 1:110203051-110203073 GCATCATTCCAGCCTGGAGCTGG - Intergenic
917525384 1:175783733-175783755 GCCTCAGTCCAGGTTACAGAGGG + Intergenic
918588454 1:186214442-186214464 GCATAATTCCAGGTTAGTGTGGG - Intergenic
918820725 1:189250655-189250677 GCTTCATGCGAGGTTACAGCTGG - Intergenic
919312655 1:195930744-195930766 GCATCATGGGAGGTTAAAGCAGG - Intergenic
919960500 1:202462883-202462905 AAATCATTCCAGGTGAAAGCAGG - Intronic
1066256782 10:33687363-33687385 GCATCATTCCACGATAGGGCTGG + Intergenic
1068571012 10:58629236-58629258 GAATCAATGCAGTTTAAAGCTGG + Intronic
1070370850 10:75780498-75780520 GGATCACTGCAGGTCAAAGCAGG + Intronic
1072533993 10:96345938-96345960 GCATCATTCCAGGCTCAGTCTGG + Exonic
1073117789 10:101101817-101101839 GCCACATTCCAGGTGAAAGGTGG + Intronic
1074073342 10:110096551-110096573 GAATGAGTCCAGGTAAAAGCAGG - Intronic
1075471012 10:122689251-122689273 GCATTAGTCCAGGTGAAAGATGG + Intergenic
1076909618 10:133380374-133380396 ACAGCATTCCAGGTTGAAGAAGG - Exonic
1079316847 11:19415372-19415394 ACACCCTTCCAGGGTAAAGCAGG + Intronic
1080698199 11:34621293-34621315 TCATCTGTCCAGTTTAAAGCAGG - Intronic
1080866101 11:36196580-36196602 GCATCATTCCAGGTTAAAGCAGG - Intronic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1089936371 11:122368516-122368538 ACAACATAGCAGGTTAAAGCTGG - Intergenic
1091317351 11:134623936-134623958 GCAGCATTCCAGGTAAGAGCTGG - Intergenic
1093481426 12:19607734-19607756 ACCTCATTCCAGGTTACTGCAGG + Intronic
1099296868 12:80838916-80838938 GCATCATTCCAGTTTGCACCAGG - Intronic
1100359953 12:93867749-93867771 GCATCATTCCCAGTTCAACCTGG - Intronic
1100489143 12:95061920-95061942 ACTTCATTCCAGAGTAAAGCAGG + Intronic
1101302665 12:103497379-103497401 GCATCATTCCAACTTAGAGAAGG + Intergenic
1101548968 12:105743879-105743901 GCATGGTTCCAGGTTAGAGTTGG - Intergenic
1102764244 12:115417837-115417859 ATATCATTCCAGGTAATAGCTGG + Intergenic
1104706665 12:130952510-130952532 GAATTCTTCCAGGTTAAAACTGG + Intergenic
1105067033 12:133209899-133209921 GCAACAGTCCAGGTCAAAGTTGG - Intergenic
1114149397 14:20019853-20019875 AAATCATTCAAGGTTAATGCAGG + Intergenic
1119169866 14:72526603-72526625 GCATCATTCCAGGTCATAAGAGG - Intronic
1119370045 14:74131877-74131899 TCATCATAGCATGTTAAAGCTGG + Intronic
1119936881 14:78600123-78600145 GCATCAATCCAGGACAAAACTGG - Intronic
1122045959 14:99023915-99023937 GCATCATCCCAGATTCAAGGAGG + Intergenic
1127283515 15:57512699-57512721 GCCCCAATCCAGGTTAAATCAGG + Intronic
1130046546 15:80450284-80450306 GCATCACTTCAGGCTATAGCAGG - Intronic
1135157679 16:20067379-20067401 TCATCATTCCAGGTTTGATCTGG - Intronic
1140190841 16:72814758-72814780 GCAGCATTTCATGTTAAAGCAGG - Intronic
1142811998 17:2399800-2399822 GCAACATTCCAGGCGAGAGCGGG + Intronic
1145003454 17:19321556-19321578 GCATCCTTGCAGGAGAAAGCAGG + Intronic
1146726809 17:35162846-35162868 AGAACATTCCAGGTAAAAGCTGG - Intronic
1148334932 17:46834705-46834727 GGAACCTTCCAGGTTAAAACTGG - Intronic
1155389570 18:25320005-25320027 AGAACATTCCAGGTTAAAGGAGG + Intronic
1158232599 18:55274991-55275013 GCGTCACTCCAGGTGAAAACTGG - Intronic
1159251627 18:65885739-65885761 TCATAATTCCTGGTTAATGCTGG + Exonic
1167835218 19:52062788-52062810 GTATCATTCCAGGTCAATCCTGG + Intronic
925985054 2:9207868-9207890 GCGGCATTCCGGGTTCAAGCAGG - Intronic
932051697 2:68404675-68404697 TCAGGATTCCAGTTTAAAGCAGG + Intergenic
938240384 2:129738455-129738477 GCATAATCCCAGGTCACAGCTGG - Intergenic
938575276 2:132597616-132597638 GGCTCATTCCAGGTTAAGCCTGG - Intronic
940540338 2:155008130-155008152 GTATCATTCAAGAATAAAGCTGG + Intergenic
941756931 2:169196772-169196794 TCAGCATTCCAGATGAAAGCTGG + Intronic
1171013067 20:21518926-21518948 GCATCCTTCCCCGTTCAAGCCGG + Intergenic
1173146186 20:40526509-40526531 GCATCATTTGAGGTTGAAGAGGG - Intergenic
1177509849 21:22072344-22072366 GCTTAATTTCAGATTAAAGCAGG + Intergenic
1179155831 21:38850376-38850398 CCATCAGTCCAGGTGGAAGCTGG - Intergenic
1180877715 22:19182562-19182584 GCAGCCCTCCAGGCTAAAGCTGG + Intronic
1182523768 22:30902668-30902690 ACAACATTCGAGGTTTAAGCTGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
959944332 3:112111421-112111443 GCATTTTTCCAGGTTCTAGCTGG - Intronic
961116253 3:124332519-124332541 GCATCTTTCCAATTTAAAACAGG - Intronic
965079624 3:164020267-164020289 CCATCTTTCCAGGTTAAAAAAGG - Intergenic
968675689 4:1877757-1877779 ACAGCATTCCAGGTCAAAGAAGG - Intronic
970271850 4:14356709-14356731 GCATCATTCCTGGTTACCACAGG - Intergenic
974811209 4:66948460-66948482 GCATATTTCCAGGTTAAATTTGG - Intergenic
981973499 4:150694706-150694728 ACAGCATTCAAGGTTAAAACAGG + Intronic
986927938 5:12781629-12781651 GCATTATACCAGGTTACAGATGG - Intergenic
996852563 5:127968677-127968699 GCATCATTACAGGTACAACCTGG - Intergenic
998099668 5:139421842-139421864 CCATCATTCCAGGTCAATCCAGG - Intronic
998417837 5:141958450-141958472 GCATCAGTCCACGTGCAAGCAGG - Exonic
1002616154 5:180457757-180457779 TCATCATTCCAGGGTCAGGCTGG - Intergenic
1004067337 6:12261716-12261738 GCCTCATCCCAGGTGAAACCTGG - Intergenic
1004619621 6:17321521-17321543 CCATCTTTCCAGGTTAAAAAGGG - Intergenic
1005624237 6:27648286-27648308 GCAGCATTTCAGAGTAAAGCAGG + Intergenic
1012610028 6:101206016-101206038 TCATCATGACAGTTTAAAGCTGG + Intergenic
1015040558 6:128712754-128712776 GCTTTATTTCAGATTAAAGCTGG - Intergenic
1018025486 6:159802409-159802431 GCATCATTCATAGTAAAAGCAGG - Intronic
1018725883 6:166613157-166613179 GAAGGATTCCAGGTAAAAGCAGG - Intronic
1021091058 7:16483310-16483332 GAATCATTCCAAGTTAAGTCAGG - Intronic
1023216416 7:37867860-37867882 TCATCATTCCAGGTGTAACCTGG - Exonic
1024640027 7:51320877-51320899 GAAGCAGTCCAGTTTAAAGCAGG + Intergenic
1033585350 7:142770739-142770761 GCATCCTTCCAGGAAACAGCCGG + Intergenic
1036693756 8:10961315-10961337 GCATCATTCCAGGCAAGAGGAGG + Intronic
1038453766 8:27657953-27657975 AGATTGTTCCAGGTTAAAGCAGG - Intronic
1040133876 8:43829694-43829716 GCATCTTTCCAGTTTTAATCTGG - Intergenic
1041423213 8:57692659-57692681 ACAGAATTCCAGGTTAAAGAAGG + Intergenic
1043722184 8:83558616-83558638 ACATCCTTCCAGGTTATTGCAGG + Intergenic
1050361998 9:4839036-4839058 GCATCACTCCAGGTTAATTGTGG - Intronic
1053458158 9:38247184-38247206 GCATCATTCCAGCCTGAAACAGG + Intergenic
1054768078 9:69059304-69059326 GTACCATTCCAGCTTCAAGCTGG + Intronic
1054782594 9:69179073-69179095 GCATCTCTCTAGGTCAAAGCAGG - Intronic
1055792770 9:79940971-79940993 GCAGAATTCCAGATGAAAGCAGG + Intergenic
1056339825 9:85616679-85616701 GCATCATTACAAGTTAAATAGGG + Intronic
1057885325 9:98825401-98825423 AACTCATTACAGGTTAAAGCAGG - Intronic
1058217048 9:102247549-102247571 TAATAATTCCAGTTTAAAGCAGG - Intergenic
1192165808 X:68827056-68827078 GGTTCATTCCTGGTTAAGGCTGG - Intergenic
1194791753 X:98159595-98159617 GCATCTTGCAAGGATAAAGCAGG + Intergenic
1195197494 X:102513787-102513809 CCATCATAGCAGGTTAAAACAGG + Exonic
1196603224 X:117625470-117625492 GCAACAATCCAGGTTAAACCTGG - Intergenic