ID: 1080866640

View in Genome Browser
Species Human (GRCh38)
Location 11:36201109-36201131
Sequence ATTTGAAGGTAGAAGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080866633_1080866640 19 Left 1080866633 11:36201067-36201089 CCAGATTGCAGTTGGGTCCTGAA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG 0: 1
1: 0
2: 1
3: 24
4: 310
1080866637_1080866640 2 Left 1080866637 11:36201084-36201106 CCTGAAAATGGGGACCAGTAGAG 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG 0: 1
1: 0
2: 1
3: 24
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080866640 Original CRISPR ATTTGAAGGTAGAAGTGTGA TGG Intronic
900408938 1:2504233-2504255 ATTAGAAGGGTGAAGAGTGAGGG + Exonic
901162422 1:7189024-7189046 ATGTGAAGCTTAAAGTGTGATGG - Intronic
901592092 1:10352847-10352869 TTTTGAAGCTAGAAGGGAGAAGG - Intronic
904327642 1:29737935-29737957 ATTTGAAGTTAGAATTGAAAAGG + Intergenic
905933940 1:41808719-41808741 ATTTGGGGGTAGAAGTGAAATGG + Intronic
905949922 1:41941484-41941506 ATTTGGTGGTGGAAGTATGAGGG + Intronic
906407563 1:45554082-45554104 ACTTGAGGCTAGAAGTTTGAGGG + Intronic
907363717 1:53943586-53943608 ATTTGGCGGTGGAAATGTGAGGG + Intronic
911421836 1:97652651-97652673 ATTTGAGGGCGGAAGGGTGAGGG + Intronic
912643090 1:111366179-111366201 ATCTAGAGGTAGCAGTGTGATGG - Intergenic
914363753 1:146959817-146959839 ATTAGAAGGTAGGGGTGTCATGG - Intronic
914381965 1:147124557-147124579 ATTAGAAGGTGGGAGTGTCATGG + Intergenic
914487921 1:148127308-148127330 ATTAGAAGGTAGGGGTGTCATGG + Intronic
915029668 1:152867298-152867320 ATTGAAAGGGAGAAGAGTGATGG + Intergenic
916352995 1:163873302-163873324 ATTTGAAGTTAGTACAGTGAGGG - Intergenic
916399424 1:164430081-164430103 ATGTGAGGCTAGAAGTGAGAAGG + Intergenic
917024191 1:170624412-170624434 AATTGGAGGTAGACATGTGAAGG - Intergenic
918739695 1:188113574-188113596 ATTTGAAGATAAAAATGTAAAGG - Intergenic
918741525 1:188137707-188137729 AATTCAAAATAGAAGTGTGAGGG + Intergenic
919151439 1:193705566-193705588 AGCTGAAGACAGAAGTGTGAAGG + Intergenic
921770653 1:219035384-219035406 ATTTAAAGGAAGAATTGGGAGGG + Intergenic
922521980 1:226261308-226261330 AATTAAAGGTAGAATTGGGAAGG + Intronic
924730798 1:246709953-246709975 ATTTGAAGCTGAAAGTGAGAAGG - Intergenic
924919083 1:248607235-248607257 TTTAGATGGTAGAAGTGTGGAGG - Intergenic
1063811702 10:9717397-9717419 ATATGAAGGTAAAACTGTGAAGG + Intergenic
1065244330 10:23742239-23742261 ATTGATAGGGAGAAGTGTGAGGG + Intronic
1065694036 10:28363255-28363277 ATTGGAAGGTCGAGGTGAGACGG - Intergenic
1066755563 10:38708720-38708742 ACTCGAAGGCTGAAGTGTGACGG - Intergenic
1067372567 10:45699166-45699188 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067387212 10:45826958-45826980 CTTTGATGGTAGATGTCTGAAGG + Exonic
1067418917 10:46130293-46130315 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067504269 10:46836882-46836904 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067876051 10:50009121-50009143 CTTTGATGGTAGATGTCTGAAGG - Exonic
1067991230 10:51214988-51215010 AGTTGAGGGTAGAAGTGACAAGG - Intronic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068203375 10:53813981-53814003 ATAGGAAGGTTGAAGTGTGGGGG + Intronic
1068828661 10:61468497-61468519 GTTTGAAGTTTGAAGTGTGGGGG - Intergenic
1069123283 10:64596563-64596585 ATCAGAAGCTAGAAGTGTGAAGG - Intergenic
1069286320 10:66720238-66720260 ATTTGAAGGTAAGAAGGTGAAGG + Intronic
1073577277 10:104637622-104637644 ATTTGAAGGTGCCAGTGTGGAGG + Intergenic
1074706812 10:116140139-116140161 TTCCTAAGGTAGAAGTGTGAAGG + Intronic
1076644328 10:131942062-131942084 ATCCTAAAGTAGAAGTGTGATGG + Intronic
1078757630 11:14226236-14226258 ATTAGAAGGGAGCAGTGTAAAGG - Intronic
1078983029 11:16560207-16560229 ATTGGAAGCTAGAATGGTGAGGG + Intronic
1080433552 11:32219704-32219726 ATTTCAAGGAAAAAGAGTGAGGG - Intergenic
1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG + Intronic
1082729536 11:56778287-56778309 ATGTCAAGGTAGCTGTGTGAAGG - Intergenic
1084995271 11:72970989-72971011 ATGTGAAGGTTGAATTCTGAGGG - Intronic
1085227719 11:74937339-74937361 ATTTGGAGATAAAAATGTGAAGG - Intronic
1086018139 11:82192255-82192277 ATTTGAACATAGAAGGATGAAGG - Intergenic
1086935638 11:92743072-92743094 ATTTGATGGCAGAATTCTGAGGG - Intronic
1088858197 11:113775329-113775351 ATTTGTAGGTAGATGAGGGATGG + Intergenic
1090590773 11:128265246-128265268 ATTTGAAGGGAGTTGTGAGATGG - Intergenic
1091730318 12:2876239-2876261 ATTTGAAGGTAGAGGTGTGGAGG - Intronic
1095445497 12:42278174-42278196 ATTTGTAGATAGAACTGAGAAGG - Intronic
1095722279 12:45413603-45413625 ATTTGAAGAGTGAAGAGTGAGGG + Intronic
1097497694 12:60362047-60362069 ATTTTAAGATAGAAGTGTGTAGG + Intergenic
1098509458 12:71294425-71294447 GTTTGAAGGTAGAAGTTTAATGG + Intronic
1098752108 12:74306905-74306927 ATTGGAAGATAGAAGTATCAAGG + Intergenic
1098784786 12:74738484-74738506 TTTAGAAGGGAGGAGTGTGAGGG - Intergenic
1098804992 12:75012428-75012450 ATTTGGATATATAAGTGTGATGG + Intergenic
1098914715 12:76245315-76245337 ATTTTAAGCAAGAAGTTTGATGG - Intergenic
1099144572 12:79024084-79024106 GGTTGAAGGAGGAAGTGTGAAGG + Intronic
1099218014 12:79877146-79877168 AGTGGAGGGAAGAAGTGTGAGGG + Intronic
1099600596 12:84731741-84731763 ATTTTAAGCTAAAAGTGTGTAGG - Intergenic
1099847373 12:88044880-88044902 AGTTGAGGCTAGAAGTGTGGTGG + Intronic
1100899498 12:99221827-99221849 ATATGAAGGCATATGTGTGATGG - Intronic
1101268563 12:103118336-103118358 ATTGGAAGGTGAGAGTGTGAGGG + Intergenic
1104271000 12:127282194-127282216 AGCTGAAGGTACAAGTTTGAAGG - Intergenic
1105547131 13:21359179-21359201 CATTGAAGGTAGAAGAGTGCAGG - Intergenic
1107739874 13:43438398-43438420 ATTGGAATGTGGAAGTGAGAGGG + Intronic
1107855907 13:44615271-44615293 ATCAGATGGTGGAAGTGTGAGGG + Intergenic
1108760762 13:53560986-53561008 AGTTGCAGGGAGAAGTGGGAGGG - Intergenic
1110355841 13:74566327-74566349 ATTTGCAGATATAAGTGTCAAGG - Intergenic
1110369232 13:74720977-74720999 CTTTGAAGGTTGAAGATTGAAGG + Intergenic
1111164008 13:84433352-84433374 CTCTGAAGATAGAAGTCTGAGGG + Intergenic
1111786771 13:92796848-92796870 ATTAAAAGTTAGAAATGTGAGGG - Intronic
1113546125 13:111152922-111152944 AGTCCAAGGTAGAATTGTGAGGG - Intronic
1113991974 14:16035177-16035199 ATGTGACGGGAGAAGTGTCAAGG - Intergenic
1115454762 14:33589394-33589416 ATTTGAAGGTTGCTGTCTGAAGG - Intronic
1116447371 14:45026035-45026057 ATTAGAAGATAGAAATGTGAAGG - Intronic
1117725588 14:58669708-58669730 ATTTGGAGGTAGAAATATGATGG + Intergenic
1118497397 14:66322024-66322046 ATTTTAAGGTAAAAGTTTAACGG - Intergenic
1118667026 14:68081448-68081470 ATTTAAAAGGAGAAGAGTGAGGG + Intronic
1121302831 14:92885586-92885608 AGGTGAGGGTTGAAGTGTGAAGG + Intergenic
1123136010 14:106027733-106027755 ATTTGCAGGTAGCAGTGGGCAGG + Intergenic
1124663801 15:31574021-31574043 ATTAGATGGTAGAAGAGAGAGGG + Intronic
1124702891 15:31932342-31932364 AGTTGGAGGTAGCAGTGTGCTGG - Intergenic
1125441261 15:39706674-39706696 ATTTAAAGGGAAAAGTGTGTTGG - Intronic
1126984272 15:54285378-54285400 ATTTGAAGATAATAGTGTTAGGG + Intronic
1127170377 15:56294361-56294383 ATCTGAAGGAAGAAGAGTCAAGG - Intronic
1127489218 15:59446541-59446563 TGTTGGAGGTAGAAGGGTGAGGG - Intronic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129639173 15:77356122-77356144 ATGTCAAGGAAGAAGTCTGAAGG + Intronic
1130770456 15:86918447-86918469 ATTTGAAGAAGAAAGTGTGAAGG - Intronic
1130883504 15:88074716-88074738 GTTTGATGGTAGAAATGGGATGG - Intronic
1131593353 15:93772566-93772588 AAAAGAAAGTAGAAGTGTGATGG + Intergenic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1134589977 16:15444578-15444600 TATTGATGGTAGCAGTGTGAAGG + Intronic
1134600763 16:15531856-15531878 ATTTGAAGGAAAATGTGGGAAGG - Intronic
1134756583 16:16672715-16672737 ATTTGAAGGTAGAACTCCCAGGG + Intergenic
1134989485 16:18686448-18686470 ATTTGAAGGTAGAACTCCCAGGG - Intergenic
1135967406 16:27047528-27047550 GGTTGAAGGTATAAGTGAGAGGG - Intergenic
1136727122 16:32368121-32368143 ACTCGAAGGCTGAAGTGTGATGG + Intergenic
1137046289 16:35665469-35665491 AATTGAAGGAAAAAGTGTTAAGG + Intergenic
1137346977 16:47672218-47672240 ATTTTAAGGGATAAGAGTGAAGG - Intronic
1137940922 16:52683578-52683600 ATTGGAAGATGGAAATGTGATGG + Intergenic
1138857909 16:60717291-60717313 ATTTTAAGGTAGAATTGCAAAGG - Intergenic
1202999312 16_KI270728v1_random:149627-149649 ACTCGAAGGCTGAAGTGTGATGG - Intergenic
1203130910 16_KI270728v1_random:1686037-1686059 ACTCGAAGGCTGAAGTGTGATGG - Intergenic
1144110675 17:12028561-12028583 TTTTGAAGTTGGAAGTTTGAAGG + Intronic
1144785017 17:17826714-17826736 GTTTGAAGGTAGAACTGGGGAGG - Intronic
1145981090 17:29012088-29012110 ATTGGGAGGTAGTAGGGTGAAGG - Intronic
1147498996 17:40944195-40944217 CTTTAAAGGTAGGAGTGGGAGGG - Intergenic
1148868527 17:50642050-50642072 ATTTGAAGGTAGAATGGACAGGG + Intronic
1149264402 17:54911832-54911854 ATTTCAGGGTACAGGTGTGATGG + Intronic
1149337012 17:55645653-55645675 AGTTGAAGGTACAAGTAAGAAGG + Intergenic
1149399082 17:56275518-56275540 AGTTGAAAGTTTAAGTGTGATGG + Intronic
1150206722 17:63414636-63414658 CTTTCAAGGTAGAATTCTGAGGG - Intronic
1150958271 17:69886262-69886284 ATTTGTAGGTTGTAGTGTTAAGG + Intergenic
1151789257 17:76293724-76293746 ATTGGAATGTAGAAGACTGATGG + Exonic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1153544076 18:6188109-6188131 ATTCCAAGGTAGAAAAGTGAGGG - Intronic
1156041135 18:32824179-32824201 ATATGAAGGCAGAAGAATGAAGG - Intergenic
1157117088 18:44871984-44872006 GTTTGGAGGTAGAAGAGTCAGGG - Intronic
1158079706 18:53575487-53575509 ATTTGAAGCTGCAAGTCTGAGGG + Intergenic
1158114996 18:53985359-53985381 AATTGAAGGGAGAATTTTGAGGG + Intergenic
1159285169 18:66339308-66339330 ATTAGTAGGTAGAAATGAGAGGG + Intergenic
1159395670 18:67852942-67852964 ATTTGAAGGTAGAGGGTAGAAGG - Intergenic
1159899849 18:74036007-74036029 TATTGAAGGTACAAGAGTGAAGG - Intergenic
1164285214 19:23809010-23809032 ATTTGAAGGAAGAACACTGAAGG - Intronic
1166707281 19:44914942-44914964 CTTGGAAGGTAAAAGTGGGATGG + Exonic
1166709385 19:44927026-44927048 CTTGGAAGGTAAAAGTGGGATGG + Intergenic
925473385 2:4186498-4186520 ATTAGAAATTAGAAGTGTGCAGG + Intergenic
925483389 2:4301725-4301747 ATTTGTAGGTATATGTGTGTGGG + Intergenic
925861223 2:8177772-8177794 AGTTGCAGGAAGTAGTGTGAAGG - Intergenic
928355780 2:30613457-30613479 ATTTTAAGGTGGAAGTGTAGGGG + Intronic
928359429 2:30650809-30650831 ATTTGAAGGTAGTAGAGGGTAGG + Intergenic
928638058 2:33267791-33267813 ATTTAAATGTAGCTGTGTGAAGG + Intronic
929002544 2:37362271-37362293 ATTTGAAGCTAGAACTTTCAAGG + Intronic
929007825 2:37412564-37412586 ATTTGAAAGAAAAGGTGTGAAGG + Intergenic
929829158 2:45333653-45333675 CTTTGAAGGGAAAAGGGTGAAGG + Intergenic
931461640 2:62455066-62455088 ATTTTAAGGTTGGATTGTGATGG - Intergenic
933090874 2:78114576-78114598 CTTTGAAAGTAGAAATGTGTGGG + Intergenic
934318863 2:91952958-91952980 ACTCGAAGGCTGAAGTGTGACGG - Intergenic
935601137 2:104922539-104922561 ATTTGAAGGTAGATTTGAGCAGG + Intergenic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
935957160 2:108388690-108388712 AGGTGAAGCTGGAAGTGTGAAGG - Intergenic
936410943 2:112257585-112257607 TTTTGCAGGGAGAAGTGTTAAGG - Intergenic
936985028 2:118301070-118301092 TTTTGAAGGAAGAAATATGAAGG + Intergenic
937564824 2:123272178-123272200 ATTAGTAGATAGAAATGTGAAGG - Intergenic
937637213 2:124169783-124169805 ACATGAAGGGAGCAGTGTGAAGG + Intronic
939569131 2:143819345-143819367 ATTTGGTGGTAGAAGGGGGAGGG + Intergenic
941852295 2:170195925-170195947 ATTTTTAGGTATATGTGTGATGG - Intronic
942572375 2:177327286-177327308 ATATAAAGGTAGGAGTATGAAGG + Intronic
942780076 2:179631236-179631258 AAATGAAGGAAGAAGTGTTAAGG + Intronic
943404271 2:187460694-187460716 AGTTGAATGTAGAAGTCTGAGGG - Intergenic
943752071 2:191519849-191519871 ATTTGAAGGTTGGAGTGACAGGG - Intergenic
944377844 2:199068752-199068774 ATTTGAAGTCATGAGTGTGAGGG + Intergenic
946524001 2:220497902-220497924 TTTTGAAGGTAGAAGCTGGAAGG + Intergenic
946971066 2:225092389-225092411 ATTTTTAGGGAGAAGTTTGAAGG - Intergenic
948271002 2:236673125-236673147 ATGTGAATATGGAAGTGTGAGGG + Intergenic
1169899995 20:10543167-10543189 TTTTGAAGGTAGAACTGTTAGGG + Intronic
1170210055 20:13839148-13839170 ATTTGAAGGTGGAAGTAGGAGGG + Intergenic
1170385217 20:15809138-15809160 TTTAAAAGGTAGAAGTGGGAGGG - Intronic
1171812603 20:29757242-29757264 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1171868672 20:30508982-30509004 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1172211272 20:33200175-33200197 ATTTAAAGGCAGAAGTGACAGGG - Intergenic
1173784903 20:45785796-45785818 ATTTGGAGGTAGAAGTGACAGGG - Intronic
1174135502 20:48376147-48376169 AGTTGAGGGTAGAGGAGTGATGG + Intergenic
1174354962 20:49991334-49991356 ATTTAGAGGCTGAAGTGTGAGGG + Intergenic
1178072440 21:28983636-28983658 ATTTGAACTTAAAAGTGTAATGG + Intronic
1180307036 22:11136619-11136641 ACTTGAAGGCTGAAATGTGATGG - Intergenic
1180315296 22:11272350-11272372 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1180545556 22:16498802-16498824 ACTTGAAGGCTGAAATGTGATGG - Intergenic
1181518102 22:23428163-23428185 AGTAGAAGGTAGAAGAATGATGG - Intergenic
1181541749 22:23576910-23576932 ATTTGAGGTTAGCAGGGTGAGGG - Intronic
1182162617 22:28138091-28138113 TTTTGAAGGGAGATGTGTCAAGG + Intronic
1184357007 22:43988752-43988774 ATTTGCAGGTGGAAGTGAGTTGG + Intronic
1184624738 22:45716180-45716202 ATTCGAACCTAGAAGTTTGAGGG + Intronic
949783720 3:7717946-7717968 ATTGTAAGGCAGAAGGGTGAAGG - Intronic
950531170 3:13553071-13553093 ATATGAAGGTACAGGGGTGAGGG + Intronic
951359965 3:21713506-21713528 ATTTGAAGCTAGGAGAGAGAAGG - Intronic
951477910 3:23127976-23127998 ACTTGAAGGAAGAAGTGAGAAGG + Intergenic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
954508449 3:51099787-51099809 ATTTGAAGGGATAAGTGTTATGG + Intronic
955464756 3:59225256-59225278 AAATGAAGGAAAAAGTGTGAAGG - Intergenic
956241951 3:67140830-67140852 AAATGAAGGAAAAAGTGTGAAGG - Intergenic
956767940 3:72500115-72500137 TTTTGAAGGGAGAAATGTCAAGG + Intergenic
957168343 3:76704671-76704693 ACTTGAAACTAGAATTGTGAAGG + Intronic
958505905 3:94976813-94976835 ATTAGAAGGAATAAGTTTGAGGG + Intergenic
959805545 3:110548487-110548509 ATGTGAAGGTATATGTGTGGGGG - Intergenic
962596654 3:136953360-136953382 ATTTGAGGGTTGAAGAGTGAGGG + Intronic
963380534 3:144524406-144524428 AGTTGAAGGTAGAAAAGGGAAGG + Intergenic
963556360 3:146793286-146793308 ATTTCAAGCTAGAAATGTAAAGG - Intergenic
963948656 3:151174014-151174036 ATTTGAGAGTAGAAGTGTTTAGG + Intronic
964284539 3:155103041-155103063 AGTTGAAGGTAGAGGAGAGAGGG - Intronic
965235028 3:166107197-166107219 ATTTGAAGGTGAAAAAGTGAAGG + Intergenic
965314036 3:167167993-167168015 ATTTAAAGGAAGCAGTGAGAAGG + Intergenic
966462404 3:180191279-180191301 ATTGGAAGTGAGAAGAGTGAAGG + Intergenic
967210479 3:187163702-187163724 ACTTGAAGGTAGAAATCTGTAGG + Intronic
968280151 3:197471092-197471114 ATTTGGAGCTAGGGGTGTGAAGG - Intergenic
970327961 4:14947730-14947752 ATTTGTAGGTGAAAGTGGGAAGG + Intergenic
970811695 4:20101967-20101989 ATTTGAATGTAGGAATATGATGG + Intergenic
971295646 4:25387717-25387739 ATTTGGAGTTAGAATTGAGAAGG + Intronic
971953457 4:33384189-33384211 CTTTGAAGGTAGAAGAGAGTGGG + Intergenic
973228922 4:47819759-47819781 ATTTGGAGGTAGAAGGCTGGTGG - Intronic
974044232 4:56884300-56884322 ATTTGAAAGTAGAAGTCTAGTGG + Intergenic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
975265858 4:72366291-72366313 TTTTGAAGGCAGAAGTTTGGTGG - Intronic
975565009 4:75745019-75745041 ATTTGAAGGGATAAGGGAGAAGG - Intronic
976569634 4:86593954-86593976 TTCTGAAGTTAGAAGTGTGGGGG + Intronic
976674168 4:87685871-87685893 CTTTGAAGATAAAAGTGTTATGG - Intergenic
977734864 4:100401810-100401832 CTTTGAAGGCTGAAGAGTGAAGG - Intronic
977951206 4:102972359-102972381 ACTCGAAGGCTGAAGTGTGATGG - Intronic
978337743 4:107688086-107688108 ATGTGAAGGTAGGAGTGGCAGGG - Intronic
978900554 4:113944158-113944180 ATTTGCAGGTAGAAGTGACAGGG + Intronic
978987119 4:115026929-115026951 ATTTGAAGAAAGAAGAATGATGG + Intronic
979180839 4:117725101-117725123 AATTGAAATTAGAACTGTGATGG + Intergenic
979935328 4:126686767-126686789 AGTTAAAGGTTGAAATGTGATGG + Intergenic
980624295 4:135353038-135353060 CTCTGGAGGTAGAACTGTGATGG + Intergenic
981221026 4:142235111-142235133 CTTTGAAGATAGCACTGTGAAGG + Intronic
981804055 4:148692259-148692281 ATTTGAAGTGAGGAGTGGGATGG + Intergenic
982067687 4:151668884-151668906 ACTAGAAGTTAGAAGTGTGCTGG - Intergenic
982519272 4:156392958-156392980 ATTTTAAGGTAGAATGGTGCTGG + Intergenic
983300389 4:165918141-165918163 ATTTGAAGGAAAAATTGTCAAGG + Intronic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984238450 4:177189706-177189728 ATATGAAAGTAGAAGAGTAATGG + Intergenic
984874934 4:184359081-184359103 ATTTGGAGGCAGCAGTGGGATGG + Intergenic
985430296 4:189872781-189872803 AGGTGAAGCAAGAAGTGTGATGG + Intergenic
985761019 5:1748834-1748856 ATTCGCACGCAGAAGTGTGAAGG - Intergenic
986514529 5:8547438-8547460 ATTTGAAGGAACAATGGTGATGG - Intergenic
986534729 5:8775372-8775394 CTCTGCAGGTGGAAGTGTGAGGG - Intergenic
990013566 5:51029508-51029530 TTTTGAAGGTAAAATTTTGAAGG - Intergenic
990073861 5:51818331-51818353 ATTTAAAGGAAAAAGTGTGCTGG + Intergenic
990659021 5:57991796-57991818 ATTTGAAGCCTGAAGTGTTATGG + Intergenic
990829474 5:59940558-59940580 TTTTGAAAGTAGATGTTTGATGG + Intronic
992622274 5:78605625-78605647 ACTTTAAGGTAGAAGTGTAAAGG - Intronic
995233900 5:109803602-109803624 ATATGAAGGCAGAATTGTCATGG + Intronic
995314013 5:110746811-110746833 TTTTTAAAGTAGACGTGTGAAGG + Intronic
995406443 5:111802224-111802246 AGTTGAAAGTTTAAGTGTGATGG + Intronic
995680043 5:114705683-114705705 ATTTGACTGTAGAAGTGGGCAGG + Intergenic
996117982 5:119639656-119639678 TTTTGAAGGTAGATGTTGGAAGG + Intergenic
996297272 5:121935919-121935941 ATTTGAAGAAAGTAGTGTCAGGG + Intergenic
996439709 5:123476175-123476197 ATCTGAAAGTAGAAGGGTCAGGG - Intergenic
996633331 5:125663476-125663498 TGTTGAAGGTAAAAGAGTGATGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997744131 5:136283975-136283997 ATTTGAGGGTAGGAGTGGGCAGG - Intronic
998248166 5:140528945-140528967 ACTTGCAGGTAGAAATGTGGTGG - Exonic
998879896 5:146635141-146635163 ATTTGAAAGTAGAAATATTAAGG - Intronic
1000481737 5:161785242-161785264 AATTAAAGGTATATGTGTGAAGG + Intergenic
1001868431 5:175127086-175127108 ATTGAAAGGTAGAACTGTCAAGG + Intergenic
1002164886 5:177337991-177338013 GTTTGAAGGCTGAACTGTGAGGG + Intronic
1002840126 6:898252-898274 ATTTGAGGAAGGAAGTGTGATGG + Intergenic
1004560361 6:16743841-16743863 ACTTGAAGGAGGAAGTGCGATGG + Intronic
1004868171 6:19874723-19874745 ATTTGAAGGGTGAAGGCTGATGG - Intergenic
1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG + Intergenic
1006989186 6:38198980-38199002 CTTTGAAGGTGGAGGTGTGCAGG + Intronic
1007644057 6:43367200-43367222 AGTTGAAGTTAGAAATGCGATGG - Intronic
1007864845 6:44956763-44956785 ATATGAATGAAGAAGAGTGATGG - Intronic
1009420616 6:63460500-63460522 ATTTCAAGGTAAAAGAGTAAAGG - Intergenic
1009974655 6:70659893-70659915 ATTTGAAGGCAGATGCCTGATGG - Intergenic
1010063995 6:71659033-71659055 TTTTCAAGGTAGTAGGGTGATGG - Intergenic
1010106997 6:72182140-72182162 ATCTGAAGGTGGAACTGTAAGGG - Intronic
1010823980 6:80450646-80450668 ATTAGAAGGGTGAAGTGTGAAGG - Intergenic
1011859248 6:91734597-91734619 ATCTGAAGCTGTAAGTGTGAAGG + Intergenic
1012411100 6:98958034-98958056 CTTTGAAGGTAGCATTTTGATGG + Intergenic
1012629124 6:101441780-101441802 ATTTGAGGGTAAAAGTTTGAAGG - Intronic
1013731646 6:113175276-113175298 ATTTGCAGGAAGAAGCTTGAAGG + Intergenic
1014323483 6:119962128-119962150 ATTCAAAGGTAAGAGTGTGAAGG + Intergenic
1014601909 6:123423724-123423746 ATATTAAGGTAGAAGTTTAAAGG - Intronic
1014733687 6:125066404-125066426 ATTTGACTGTAGCAGGGTGAAGG - Intronic
1014769699 6:125446612-125446634 ATTAGCAAGTAGGAGTGTGATGG - Intergenic
1015392692 6:132700676-132700698 ATTTAAATGGAGATGTGTGAGGG - Intronic
1015855112 6:137616149-137616171 ATTTTAAAGCAAAAGTGTGATGG - Intergenic
1016809011 6:148241774-148241796 ATAAGAAGGTTGAAGCGTGAAGG - Intergenic
1017571003 6:155744304-155744326 CTTCAAAGGCAGAAGTGTGATGG - Intergenic
1018614959 6:165678483-165678505 ATTTCAAACTGGAAGTGTGAAGG + Intronic
1021221305 7:17977968-17977990 ATTAGAAGGTAGAAGAGGCAAGG - Intergenic
1021247802 7:18285403-18285425 ACTTTAAAGTAGCAGTGTGATGG + Intronic
1022263382 7:28729294-28729316 AATTCTAGGTAGAAATGTGAAGG - Intronic
1024504714 7:50152402-50152424 ATTTGAAGCTACTAGTGAGAAGG + Intronic
1024788180 7:52932088-52932110 ATATGAAGGTCAAAGTGGGAAGG - Intergenic
1029839172 7:103344364-103344386 ATTAGAAGGAAGGAGGGTGAGGG - Intronic
1031272871 7:119675719-119675741 ATTTGAAGAGAGAAATTTGAAGG - Intergenic
1031484245 7:122309317-122309339 CTTTGGGGGAAGAAGTGTGAGGG + Intronic
1032544032 7:132727220-132727242 ACTTGAAATTAGAAGTGGGAGGG - Intronic
1033382585 7:140837676-140837698 ATTTTCAGGCAGTAGTGTGAAGG - Intronic
1038592827 8:28856198-28856220 TTTAGAAGGTAAAAGTGTCAAGG + Intronic
1038682399 8:29681142-29681164 ATCTGAAAGTAGAAGTGGAAGGG - Intergenic
1041391687 8:57352758-57352780 TTTTGGAAGTAGATGTGTGATGG - Intergenic
1041809976 8:61897132-61897154 ATTTAGAGGTAGAATTGTCAAGG - Intergenic
1041855276 8:62445755-62445777 TTTTGAAGGTAGATTTTTGATGG - Intronic
1043224811 8:77712759-77712781 ATTTGAGGGTGTAAGTGTGATGG - Intergenic
1043864235 8:85357589-85357611 ATTTGAAGGTAGCAGGGAAAAGG + Intronic
1045211569 8:100105565-100105587 AATTCAAGGTGGAAGTGGGAAGG + Intronic
1045336525 8:101208722-101208744 ATTTGGAGATAGAAATGTGGGGG - Intergenic
1045618342 8:103944220-103944242 ATTTGAAAATAGAAGTGTATGGG - Intronic
1046755231 8:117966170-117966192 ATATGAAGTTACAACTGTGATGG - Intronic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1047871209 8:129084153-129084175 ACTTGATGGCAGAAGTATGATGG - Intergenic
1048478285 8:134763102-134763124 ATTAGAAAGAAGAAATGTGAAGG + Intergenic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1050234943 9:3567853-3567875 ATTTGACAGTAGAAGAGTTATGG - Intergenic
1051239857 9:15042669-15042691 ATTTGTATGTAAAACTGTGATGG + Intergenic
1051654994 9:19371565-19371587 ATTTGGAGGAAGCTGTGTGAAGG - Intronic
1054898463 9:70341106-70341128 TTTTAAGGGTAGAAGTGGGAAGG - Intronic
1054918216 9:70515635-70515657 CATTGAAGGTAGAAGTGTGGGGG + Intergenic
1058148937 9:101443035-101443057 TTTTGAGGGTGGAAGTGGGATGG - Intergenic
1058809764 9:108628072-108628094 AATTGTAGGGAGAAGTGAGAGGG - Intergenic
1058854207 9:109044295-109044317 ATTTGAAGCAAGGAGTGGGATGG + Intronic
1059918622 9:119132932-119132954 TTGTGAAGGTAGAATTTTGATGG - Intergenic
1059918625 9:119132976-119132998 GTTTGATGGTAGAATTTTGATGG - Intergenic
1059918626 9:119132990-119133012 TTTTGATGGTAGAAGTTTGATGG - Intergenic
1059918916 9:119135931-119135953 TTTTGATGGTAGTATTGTGATGG - Intergenic
1203363583 Un_KI270442v1:238259-238281 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1203651132 Un_KI270751v1:124005-124027 ATTTCAGGGGAGAAGGGTGAAGG - Intergenic
1185782570 X:2862069-2862091 AGAAGAAGGTGGAAGTGTGAAGG + Intronic
1186651866 X:11569755-11569777 ATTTGAGCGAAGAAGTGTGAAGG - Intronic
1186807885 X:13158400-13158422 ACTTGAAAGTAGATTTGTGATGG - Intergenic
1187668005 X:21636701-21636723 ATTTTAAGATAGAAGTGGGAAGG + Intronic
1189497695 X:41524439-41524461 ATTTGAAATTTGAAATGTGAGGG - Intronic
1190157008 X:48002431-48002453 ATTAGAATGTAGAGGTGTGCAGG - Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1195383645 X:104293557-104293579 GTTTGGAGGTAGAAGTGTTTTGG - Intergenic
1195400291 X:104454136-104454158 ATTTGAAGGCATAATTGTGATGG + Intergenic
1195430430 X:104783168-104783190 ATTTGAATGTAGATGTGAGTGGG + Intronic
1197610138 X:128629081-128629103 ATTTGAAGATGTAAGTTTGAAGG + Intergenic
1198504293 X:137286003-137286025 ATTTGAAGGTTGGACTGGGAAGG + Intergenic
1198519477 X:137438315-137438337 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1201180615 Y:11340496-11340518 ATTTTAAAGTAGAAGTATGTAGG - Intergenic
1201186412 Y:11408042-11408064 ACTCGAAGGCTGAAGTGTGACGG - Intergenic
1201551457 Y:15221026-15221048 ATTCAAAGGTAGAAGTGTTTTGG + Intergenic
1201903594 Y:19067462-19067484 TTTTGAAGGTAGAAGCCTGCTGG - Intergenic