ID: 1080866986

View in Genome Browser
Species Human (GRCh38)
Location 11:36204205-36204227
Sequence AGGCTCTGGGCAGAACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080866986 Original CRISPR AGGCTCTGGGCAGAACATCC TGG Intronic
901437390 1:9255985-9256007 AGGCTCTGGGTCGAACTGCCTGG + Intronic
902137233 1:14319663-14319685 AAGCTCCGGGCAGAACATCAGGG + Intergenic
902536516 1:17121993-17122015 AGGCTCTGGGCCCAACATGATGG - Intergenic
905272439 1:36795883-36795905 AGGCTCTGGGCTGAGCCCCCAGG - Exonic
905448151 1:38040834-38040856 AGGCCCTGGGTAGATCATCTTGG + Intergenic
906024290 1:42659570-42659592 AGGCTCTTGGCAAGCCATCCTGG + Intronic
906193262 1:43912766-43912788 CTGCTCTTGTCAGAACATCCAGG - Intronic
906344993 1:45009539-45009561 AGGCTCTGGGCAGGACAGGGTGG - Intronic
906632961 1:47387823-47387845 AGGCACTGGGGAGGACACCCAGG - Intergenic
915734812 1:158078022-158078044 AGACGCTGGGCAGTACAACCTGG + Exonic
915844926 1:159252826-159252848 ATGCTCTGGACAGAACCTCCAGG + Intergenic
916174740 1:162028738-162028760 AGGCTCTGAGCAAAAGATGCAGG - Intergenic
916188963 1:162160441-162160463 ATGCTCTTAGGAGAACATCCAGG + Intronic
916475224 1:165162543-165162565 AGGCTCTGGGCTGAACAAAAAGG + Intergenic
916986984 1:170202224-170202246 AGTCTCTGGGTAGGAAATCCAGG - Intergenic
919090340 1:192971318-192971340 TGGCTCAGGACAGAAAATCCTGG - Intergenic
920986613 1:210896643-210896665 AGGCTCTTTCCAGAACATTCTGG + Intronic
921099987 1:211920429-211920451 AAGCTCTGGGCAGGGCATCTTGG - Intergenic
922193586 1:223340647-223340669 AGGCTCCAGGCAAAAGATCCAGG + Intronic
923045261 1:230350898-230350920 AGGGTCGGGGAAGAAAATCCGGG - Intronic
1063515005 10:6687201-6687223 AGGCACTGGCCAAAACAGCCTGG - Intergenic
1063879264 10:10514129-10514151 AGGGTCTGGGAATAACATCTTGG - Intergenic
1064818815 10:19299969-19299991 AGCCTCTGGGCAGAACCTCCGGG - Intronic
1066171318 10:32850083-32850105 AGTTTCTGTGAAGAACATCCTGG - Intronic
1067414160 10:46091277-46091299 AGGCTCTTAGCAGAACCCCCAGG - Intergenic
1067434207 10:46265792-46265814 AGGCTCTTAGCAGAACCCCCAGG - Intergenic
1067439486 10:46300538-46300560 AGGCTCTTAGCAGAACCCCCAGG + Intronic
1067448517 10:46367445-46367467 ATGCCCTGGGCAAAGCATCCTGG + Intergenic
1067588857 10:47493320-47493342 ATGCCCTGGGCAAAGCATCCTGG - Intergenic
1067635983 10:48001411-48001433 ATGCCCTGGGCAAAGCATCCTGG - Intergenic
1067715948 10:48691283-48691305 AGGCTCTGCACAGGACACCCAGG - Intronic
1067877504 10:50018916-50018938 ATGCCCTGGGCAAAACATCCTGG + Intergenic
1070132547 10:73665419-73665441 ATGCCCTGGGCAAAACATCCTGG - Intergenic
1070952429 10:80442003-80442025 AGGAACTGGCCAGAACAGCCTGG + Intergenic
1071829687 10:89359487-89359509 AGGCCCTGGGCAGGTCAACCTGG - Intronic
1073109237 10:101050892-101050914 AGTCCCTGGGGAGAACCTCCAGG - Intergenic
1073297795 10:102451353-102451375 AGTCACTGGGAAGAGCATCCCGG - Intronic
1074055846 10:109922719-109922741 AGGCTCTGATAAGTACATCCTGG + Intronic
1075419101 10:122287712-122287734 AGGGTCTGGCCAGAAGTTCCAGG - Intronic
1075478438 10:122756893-122756915 AGGCTCTGGGAAGATCTTACTGG + Intergenic
1076052888 10:127349306-127349328 AGGATGTGGGGAGAACATCTAGG - Intronic
1076449024 10:130543498-130543520 AGGCTCAGGCTAGAAAATCCCGG + Intergenic
1076523208 10:131093941-131093963 AGGCACTGGGCTGGACATTCAGG - Intronic
1076881041 10:133239369-133239391 AGGCTGTGGGAAGGGCATCCTGG + Intronic
1076914972 10:133418862-133418884 AGGCTCTGGGCAGAGAGGCCTGG - Intronic
1077413992 11:2416022-2416044 AGGCTGTGGGCAGAGCAGGCAGG + Exonic
1078067795 11:8089544-8089566 GGGCTCTGGGCTGTATATCCTGG + Intronic
1078199490 11:9167365-9167387 AGGCTGTGGGCAGAATATTTTGG - Intronic
1078441938 11:11375603-11375625 AGGCTCTGGGCGGTAGAGCCAGG - Intronic
1079876315 11:25861577-25861599 AGGCTCTGGGCATCAAATGCAGG + Intergenic
1079911432 11:26315419-26315441 AGGGTCTAGGCAGAACATGTGGG + Intronic
1080577134 11:33610022-33610044 AGGCCTTGGGCAGTATATCCTGG + Intronic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1081622708 11:44628348-44628370 AGACTCTGGTCAGGACATCTGGG - Intergenic
1083295964 11:61715849-61715871 AGGCTGTGGTCAGAACAGACTGG - Intronic
1083617171 11:64032056-64032078 AGGCTCTGTGCTGGGCATCCAGG - Intronic
1083945730 11:65921563-65921585 AGGCTCTGCGCAGGACGTCATGG + Intergenic
1084364164 11:68686664-68686686 AGGCTCTGTGGTGAACAGCCTGG - Intronic
1085349271 11:75788115-75788137 AGGCTATGGTCTGAGCATCCTGG - Intronic
1085883890 11:80499869-80499891 AGGTTCAGGGGAGAACATCGAGG + Intergenic
1086264659 11:84983330-84983352 AGGCTCTGGGCTGATAATGCGGG - Intronic
1090218011 11:124987855-124987877 AGTCTTTGGGGAGAACATGCTGG - Exonic
1090218020 11:124987903-124987925 GGTCTCTGGGTAGAAAATCCTGG - Exonic
1090218032 11:124987972-124987994 GGTCTCTGGGTAGAAAATCCTGG - Exonic
1090218044 11:124988041-124988063 GGTCTCTGGGTAGAAAATCCCGG - Exonic
1090273496 11:125404048-125404070 AGCCACTGGGCAGAACCTCTAGG - Intronic
1090410136 11:126502329-126502351 GGGCTGTGGGCAGCACAGCCAGG - Intronic
1092137991 12:6163007-6163029 AGGCACAGGGCAGAGCAGCCAGG + Intergenic
1095627851 12:44338907-44338929 AAGCTCTGGGCATAGCTTCCAGG + Intronic
1095973496 12:47922706-47922728 AAGATCTGGGAAGAGCATCCTGG - Intronic
1096216091 12:49798103-49798125 AGGCACTGTGTAGAACACCCTGG - Intronic
1096959045 12:55559242-55559264 AGGCTCTGGGCAGCTCTTCATGG + Intergenic
1097917740 12:65038735-65038757 ATGTTCTGGGGAGAACATCTGGG + Intergenic
1097923472 12:65102663-65102685 AGGCCCTGAGCTGAACATACTGG - Intronic
1101332729 12:103769973-103769995 AGCCTCTCGGCAGGACTTCCTGG + Intergenic
1102484539 12:113246982-113247004 AGACCCTGGGCAGAACCTCCAGG - Intronic
1103350977 12:120283450-120283472 AGGCTGTGGGAAGAGCATTCTGG + Intergenic
1104061574 12:125272844-125272866 ATGCTCTGCGCAGAACACTCTGG - Intronic
1105355769 13:19658087-19658109 AGCCTCTGGGCTGTCCATCCTGG - Intronic
1107571882 13:41670134-41670156 CGGCTCTTTGCAGAACAACCTGG + Intronic
1110209646 13:72956522-72956544 AGGCTCTGAGAAGAAAATGCTGG - Intronic
1110380296 13:74842568-74842590 AGGAACTGGCCAGGACATCCTGG + Intergenic
1112327319 13:98450633-98450655 AGGCTCTGGGCAGCTGAGCCAGG + Intronic
1112512254 13:100020293-100020315 AGGCTTTGGCCTGAACATTCAGG - Intergenic
1113677412 13:112216110-112216132 ACGCTCTGAACAGAACCTCCTGG - Intergenic
1114704460 14:24711254-24711276 AGGCTCTGGGTTGGACATTCTGG - Intergenic
1114882528 14:26804490-26804512 AGGCCCTGAGCAGAGAATCCAGG + Intergenic
1115771489 14:36666866-36666888 AGGCTCTGGGAAGCGCCTCCAGG + Intronic
1116932519 14:50704251-50704273 AGGCTTTGGGCACCACTTCCAGG - Intergenic
1117580325 14:57145033-57145055 AGGATCTGGGCAGAGCACCAGGG + Intergenic
1119258475 14:73220782-73220804 AGGCTCTGGGCAGCTCAGTCAGG + Exonic
1122023436 14:98858202-98858224 AGGCTCTGGGGTGGACATGCTGG + Intergenic
1122423428 14:101591362-101591384 CGGCCCTGGTCAGAACATGCTGG - Intergenic
1123487950 15:20757818-20757840 ATGCACTGGGCAGTACAGCCTGG - Intergenic
1123544451 15:21326888-21326910 ATGCACTGGGCAGTACAGCCTGG - Intergenic
1124101227 15:26695805-26695827 AGGATTTGGGAAGAACTTCCAGG - Intronic
1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG + Intronic
1125370000 15:38965135-38965157 AGGTTCTGGCCAGCACAACCAGG - Intergenic
1126411742 15:48379090-48379112 AGGGACTGGCCAGAACAGCCTGG + Intergenic
1127352209 15:58164434-58164456 ATGCTCTGGGCACAACTTCCAGG - Intronic
1127979548 15:64024638-64024660 AGGCTCAGGGCGGGACAGCCTGG - Intronic
1128128748 15:65211615-65211637 AGGATCTGGACATAAAATCCTGG - Intergenic
1131529603 15:93180225-93180247 AGGGTCAGGGAAGAACATCCTGG + Intergenic
1131546813 15:93322513-93322535 AGGCTTAGAGCAGAACAACCAGG + Intergenic
1131591236 15:93750798-93750820 AAGTTCTGGGCAGGACAACCAGG + Intergenic
1132103907 15:99049271-99049293 AGGCAATGAGCAGAACATCCAGG - Intergenic
1132117267 15:99146561-99146583 TGGGTCTGGACAGACCATCCTGG - Intronic
1202952792 15_KI270727v1_random:54157-54179 ATGCACTGGGCAGTACAGCCTGG - Intergenic
1132503007 16:292938-292960 GGGCTGTGGGCTGGACATCCAGG + Intronic
1134193626 16:12141591-12141613 AGGCTCGGGGCAGGATTTCCTGG + Intronic
1135396112 16:22132823-22132845 GGGCTCTGGGCAGCCCAGCCTGG - Intronic
1137495335 16:48965092-48965114 AGGCTCTGGAAAGAGCAGCCAGG + Intergenic
1139296981 16:65909717-65909739 AGTGTCTGGGGAGAACATGCTGG + Intergenic
1139318271 16:66092017-66092039 GGGCTCAGTGCAGAACATGCTGG + Intergenic
1139356661 16:66370981-66371003 AGGCTGTTGGCAGAACCTGCAGG + Intronic
1139377765 16:66511090-66511112 TGGCTCTGGGCAAACCAGCCAGG + Exonic
1139572568 16:67822380-67822402 AGGGACTGGGCACAGCATCCAGG - Intronic
1140384421 16:74521917-74521939 ACGCTCTGGGCAGAGTTTCCAGG + Intronic
1140420614 16:74816014-74816036 AGGCTCTGGGTAGGACAGCCAGG - Intergenic
1140453175 16:75087909-75087931 AGGCTCTGAGCGGCACACCCTGG - Intronic
1141120068 16:81346737-81346759 AGGCTCTGGGGAAAACTTCAGGG + Intronic
1141153688 16:81582265-81582287 AGGCACTGGGCTGAACATTTGGG - Intronic
1141394754 16:83694738-83694760 TGGCTCTGGGCAGACCATCAGGG + Intronic
1141528175 16:84626862-84626884 AGGTTTTGGGCTGAGCATCCAGG + Intergenic
1142976096 17:3645425-3645447 AGGCTCTGGGTAGCAGAGCCTGG + Intronic
1145210024 17:21005881-21005903 AGGACCTAGGCAGATCATCCAGG - Intronic
1147558246 17:41493291-41493313 GGGCTTTGGTCAGAACATGCTGG + Intergenic
1147598233 17:41730432-41730454 AGGCTGTGTGCAGAAGTTCCTGG + Intronic
1148695372 17:49555382-49555404 AGGCCCACAGCAGAACATCCAGG - Intergenic
1148862739 17:50613048-50613070 GGCCTTTGGGCAGACCATCCAGG + Intronic
1150122972 17:62618674-62618696 TGCCTCTGGGCAGCACATCCAGG + Intergenic
1150451224 17:65270741-65270763 AGCCATTGGGCAGAGCATCCTGG - Intergenic
1150612775 17:66747594-66747616 GGGCTCCGGTCAGAACATCTCGG - Intronic
1151747295 17:76018395-76018417 AGGCTGTGGGCAGAGCAGGCCGG - Intronic
1151852393 17:76698568-76698590 AGGTTCTGGACAGAAGTTCCTGG - Intronic
1151977942 17:77492893-77492915 AGGCTCAGGGCAGCTCCTCCCGG + Intronic
1154445589 18:14433074-14433096 ATGCACTGGGCAGTACAGCCTGG - Intergenic
1154949901 18:21199834-21199856 AGGCTCTGGGCTTAAAATCCTGG + Intergenic
1155810200 18:30223439-30223461 GGCCTCTGGGCAGCACATGCAGG - Intergenic
1160663882 19:313848-313870 AGGCTCTGGGCACCACACACAGG + Intronic
1161942705 19:7415562-7415584 AGGCCCATGGCAGAACCTCCTGG + Intronic
1162300503 19:9842282-9842304 AGGGTCAGGGCAGAACAGCGTGG + Intronic
1162588944 19:11578376-11578398 AGGGTGTGGGCAGGACTTCCTGG - Intronic
1163040726 19:14600121-14600143 ATTCTCCTGGCAGAACATCCGGG - Exonic
1163469911 19:17490012-17490034 GGGCTCTGGGCTGAGCATCTTGG + Intronic
1163519190 19:17781749-17781771 TGGCTATGGGCAGGGCATCCTGG - Exonic
1164737325 19:30551529-30551551 AGCCTTTGGGCAGCAGATCCTGG + Intronic
1168137521 19:54361192-54361214 AGGGTCTGGGCAGATCTTCTAGG + Exonic
926019495 2:9482840-9482862 AGGTTCTGGGCATCACATCAGGG + Intronic
929044627 2:37777701-37777723 AGCCTCCGGACAGATCATCCCGG - Intergenic
931072649 2:58670282-58670304 AGTGTCTGGGCACAACCTCCAGG + Intergenic
932198172 2:69802221-69802243 AGACTCTGGGAAGACCAACCAGG + Intronic
933124883 2:78592852-78592874 AGGATCTAGGCTGAACTTCCCGG - Intergenic
933943731 2:87266630-87266652 AGGCTCTAGGCAGAACATTTAGG + Intergenic
935357950 2:102221997-102222019 AGGATCAGGGAAGAACATCCAGG - Intronic
936336489 2:111594949-111594971 AGGCTCTAGGCAGAACATTTAGG - Intergenic
936441051 2:112553757-112553779 AGTCTCTGGTCATAACATTCTGG - Intronic
938250452 2:129811762-129811784 AGGCTCTGGGTAGATTATCAAGG + Intergenic
938702628 2:133893067-133893089 AGGCTCTGGGCAGGGCTTCAAGG + Intergenic
939125966 2:138177723-138177745 AGGCTCTGGGCCAATCCTCCAGG + Intergenic
940566013 2:155360933-155360955 AGTCTCTAGGCAGAAAATTCAGG + Intergenic
941436847 2:165483140-165483162 AGGCTCTGGGCAGGGCATTCAGG + Intronic
942977708 2:182038848-182038870 AGGATGTGGGCAGAAGCTCCAGG + Intronic
944105747 2:196077429-196077451 AGTCTGTGGCCAGCACATCCTGG - Intergenic
944479308 2:200139037-200139059 AGGCTCTGGCCAAAACATCAAGG + Intergenic
944683906 2:202101034-202101056 CTACTCCGGGCAGAACATCCGGG - Intronic
947794531 2:232885683-232885705 GGGCTGTGGGGAGAACAGCCCGG - Intronic
948229936 2:236342229-236342251 AGGCACAGAGAAGAACATCCAGG - Intronic
948398833 2:237667989-237668011 AGGGTCTGGGCAGGACATGAGGG - Intronic
949007105 2:241655999-241656021 AGGCTCTGGCCAGATCCCCCAGG + Intronic
949082920 2:242119840-242119862 TGGTTCTGAGCAGAACTTCCGGG + Intergenic
1169391631 20:5195721-5195743 AGGATGTGGGCAGAACTTCTAGG - Exonic
1171141464 20:22747381-22747403 AAGCCCTGGGCAGGACATCCTGG - Intergenic
1171352930 20:24518618-24518640 ACGCTCTGGGCAGAAGGTGCTGG + Intronic
1171959445 20:31483360-31483382 AGGCACTGGGCCTATCATCCTGG - Intronic
1173000409 20:39101527-39101549 AGGATCTGAGCAGACCACCCAGG + Intergenic
1173951183 20:46994617-46994639 AAGCTCTGGGCAGCTCAGCCTGG - Intronic
1174369301 20:50075730-50075752 GGGCACTGGGAAGAATATCCCGG + Intergenic
1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG + Intronic
1174647310 20:52097170-52097192 AGGCTCTGTGTAGCTCATCCTGG + Intronic
1175266703 20:57707947-57707969 TGGCTCTGGGCAGGTCCTCCTGG + Intronic
1175404808 20:58719051-58719073 AGGCTCTGGGCAGAGAATCAGGG - Intronic
1176450389 21:6856788-6856810 ATGCACTGGGCAGTACAGCCTGG + Intergenic
1176828558 21:13721806-13721828 ATGCACTGGGCAGTACAGCCTGG + Intergenic
1177752007 21:25296332-25296354 AGGAACTGGCCAGAACATCCTGG + Intergenic
1179645671 21:42774221-42774243 AGGCTCAGGGCAGGACAAACGGG + Intronic
1179707849 21:43192658-43192680 AAGCTCTGGGCAGAAGCTCTGGG - Intergenic
1179707860 21:43192722-43192744 AAGCTCTGGGCAGAAGCTCTGGG - Intergenic
1180968927 22:19804933-19804955 AGGCAGTGGGCAGGGCATCCAGG - Intronic
1180982769 22:19886672-19886694 AAGCTCTGAGCACAACATGCAGG - Intronic
1181090223 22:20467427-20467449 ACGCTCTGGCCAGATCACCCTGG + Intronic
1181361421 22:22340304-22340326 AGGCACTGAGCAGAAAACCCTGG - Intergenic
1181889057 22:26045564-26045586 AAGCATTGGGCAGAACAGCCAGG + Intergenic
1181985603 22:26798177-26798199 AGGCTCAGAGCAGGGCATCCTGG + Intergenic
1182347289 22:29675088-29675110 AGGGACTGGGTAGAACATCCTGG + Intronic
1182380184 22:29881452-29881474 ATGCACTGGGCAGTACAGCCTGG + Intergenic
1182913153 22:34004496-34004518 AAGTTCTGTGCAGAACATGCAGG + Intergenic
1183689748 22:39381985-39382007 AGGCGCTGGGCAGGGCAGCCTGG - Exonic
1183923976 22:41192492-41192514 CAGCTCTGGGCTGAACATGCTGG + Intergenic
1184974068 22:48048338-48048360 AGGATCTGGGCAGCCCATGCTGG - Intergenic
1185155100 22:49188728-49188750 TGGCTCAGGGCTGAACATCATGG + Intergenic
950263143 3:11556235-11556257 CGGCTCTGGGAAGAACTTCACGG + Exonic
950427832 3:12934204-12934226 AGGCTCAGGAGAGAGCATCCTGG + Intronic
950447752 3:13047972-13047994 AGTCTCTGGGCAGGAAATCAGGG - Intronic
950555727 3:13694879-13694901 AGGACCTGGCCAGAACACCCTGG - Intergenic
952319404 3:32262007-32262029 AGGCTCTAGGCTGAGCTTCCAGG + Intronic
952400768 3:32961283-32961305 CTGCTTTGGGCAGACCATCCAGG - Intergenic
952871996 3:37909361-37909383 AGGATCTGGGAAGAGCACCCAGG - Intronic
953500800 3:43431933-43431955 AAGCTCTGGGCAGAACCTCCTGG - Intronic
954457051 3:50605363-50605385 TGGGTCTGGGCACCACATCCAGG + Intergenic
961682405 3:128608054-128608076 AGGCCCTGGGCAGAGGACCCGGG - Intergenic
962406863 3:135108028-135108050 AGTCTTTGGTCTGAACATCCAGG - Intronic
963997322 3:151725026-151725048 AGTCTGTGGCCAGCACATCCTGG - Intergenic
964204407 3:154156951-154156973 AGGTTGCGGTCAGAACATCCTGG + Intronic
968919942 4:3517269-3517291 TGCCTCTGGGCAGACCATCCTGG + Intronic
969313339 4:6366966-6366988 AGGCTCTGGGCAGGACAGGGCGG + Intronic
969531611 4:7733819-7733841 AGGCTGTGGGCAGAGCTCCCCGG - Intronic
974216481 4:58853767-58853789 AAGCTCTGGCCAGAGCATTCAGG - Intergenic
974216797 4:58857624-58857646 AAGCTCTGGCCAGAGCATTCAGG - Intergenic
975932915 4:79547746-79547768 AGGGTCAGTGAAGAACATCCAGG - Intergenic
976773307 4:88678865-88678887 AAGTTCTGGGAAGAACAACCAGG - Intronic
977826011 4:101532537-101532559 AGGCTCTGGACACAACTTCTGGG + Intronic
979510811 4:121551484-121551506 TTGCCCTGGGCAGAACTTCCAGG - Intergenic
982265639 4:153536141-153536163 AGGATCTGGGCTGAAAATCCAGG + Intronic
982840813 4:160183843-160183865 AGGCTCTTAGCAGAATTTCCAGG - Intergenic
984858850 4:184219212-184219234 AGGCTCTGGGCAAACTTTCCAGG + Intronic
985016336 4:185639076-185639098 AGGCTCTGGGCGGAACCGCGAGG + Intronic
985542340 5:492771-492793 AGGCTCTGGCCACAACGTCAGGG - Intronic
985895455 5:2748240-2748262 AGGGTCCGGGAAGAAGATCCAGG - Intronic
987198122 5:15547749-15547771 AGGGACTGGCCAGAATATCCCGG - Intronic
987925555 5:24336492-24336514 AGTCTGTGGCCAGCACATCCTGG - Intergenic
988381660 5:30504422-30504444 AGGGATTGAGCAGAACATCCTGG + Intergenic
990051619 5:51508632-51508654 AGGCTCTGTGTAGAACATTAGGG - Intergenic
990794522 5:59524952-59524974 AGGCTCTTGCCTGGACATCCAGG - Intronic
993357195 5:86929182-86929204 AAGCTCTGGCAAGAACACCCTGG + Intergenic
994725577 5:103431516-103431538 AAGCTCTGGAAAGAAGATCCTGG + Intergenic
994804353 5:104424646-104424668 AGTCCCTGAGCAGAGCATCCTGG + Intergenic
996087834 5:119322375-119322397 AGCCTCTGAGCAGACCATGCTGG + Intronic
997689933 5:135821528-135821550 AGTCTCTGGGCAGAAGTCCCAGG + Intergenic
999192683 5:149760246-149760268 GGGCTCTGGGCAGCAGTTCCTGG + Intronic
1000936083 5:167304021-167304043 AGGCTTTTGGCACAACATCCTGG + Intronic
1002479892 5:179493121-179493143 AGGCTCTGGGTAGAAGCCCCGGG - Intergenic
1005747120 6:28848754-28848776 AGGCTCTGGGTATAATCTCCTGG - Intergenic
1006251865 6:32794317-32794339 ATGCCATGGGCAGAACATCAGGG - Intergenic
1007446667 6:41911750-41911772 AGGCTCTGCACAGATCCTCCAGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1011970768 6:93219982-93220004 GTGCTCTGTGCAGAACATGCTGG - Intergenic
1013128617 6:107209764-107209786 AGGCTCTGGACAGAGAAACCAGG - Intronic
1018433848 6:163744093-163744115 AGGCTCTGAGGCAAACATCCTGG + Intergenic
1019023699 6:168940736-168940758 AAGCTCTGGGCAGATCCTACTGG + Intergenic
1019196144 6:170284255-170284277 AGGCGCTGTGCAGAACACTCTGG + Intronic
1019937750 7:4267397-4267419 TGGCTTTGGGCAGAGCATCTAGG - Exonic
1020117443 7:5483767-5483789 AGACTCTGGGCAGAAGTTTCTGG - Intronic
1021782322 7:24118245-24118267 AGGCACTGGACAGAATTTCCTGG + Intergenic
1023271391 7:38467136-38467158 AGGCTCTGGTCTGATCTTCCTGG - Intronic
1024715470 7:52074974-52074996 AGGGTCTGTTCAGAACAGCCTGG + Intergenic
1028734367 7:94190618-94190640 AGGCTCTGGGCTGGGCCTCCAGG + Intergenic
1029877151 7:103766148-103766170 AGGCTCAGGGAAAACCATCCAGG - Intronic
1031510219 7:122639860-122639882 AGGCTTTGAGGAGAGCATCCAGG - Intronic
1031964317 7:128016648-128016670 AGTACCTGGGCAGAACACCCAGG + Intronic
1032198613 7:129804157-129804179 AGGGTCTGGGTAGAGCACCCCGG + Intergenic
1032801160 7:135318093-135318115 AGGCTCTGGCTGGAACATCGAGG + Intergenic
1033581607 7:142742161-142742183 AGGAACTGGCCAGAACAGCCAGG - Intergenic
1034191368 7:149215872-149215894 AGGGTTTGGGCAGAATTTCCTGG - Intronic
1034562533 7:151890479-151890501 AGGCTCTGGGCAGCAGAGCAGGG + Intergenic
1034999915 7:155604327-155604349 TGGGTATGGGCAGATCATCCCGG + Intergenic
1035751187 8:1997564-1997586 AGGCTCTGGGCAGCCCTTCCGGG - Intronic
1035785123 8:2253931-2253953 AGGCTCTGGGTAGCAGATGCTGG - Intergenic
1035807688 8:2467785-2467807 AGGCTCTGGGTAGCAGATGCTGG + Intergenic
1036911997 8:12765492-12765514 AGTCTGTGGCCAGCACATCCTGG - Intergenic
1041342355 8:56859109-56859131 AGATTCTGGGAAGAACATCTTGG + Intergenic
1041483488 8:58348819-58348841 AGGCACTGGTCTGAAGATCCGGG + Intergenic
1042778277 8:72460208-72460230 AGGCTCAGTGCAGACCAGCCTGG - Intergenic
1042789005 8:72582355-72582377 AGGGACTGGCCAGAACAGCCAGG - Intronic
1042892369 8:73626895-73626917 AGACTTTGAGCAGAACCTCCAGG - Intronic
1043538265 8:81230057-81230079 AGGCTCTGGGTATGACATCATGG - Intergenic
1045648823 8:104324413-104324435 AGGCCCAGCCCAGAACATCCAGG + Intergenic
1046252688 8:111653337-111653359 AGTCTATGGCCAGCACATCCTGG + Intergenic
1046395582 8:113634021-113634043 AGGCTCTGGGCAGATACCCCAGG + Intergenic
1046495637 8:115010273-115010295 AGGCTTCTGGCTGAACATCCAGG + Intergenic
1049593614 8:143473548-143473570 AGGCAGTGGGCAGAGCAGCCAGG - Intronic
1050334102 9:4574212-4574234 CAGCTCTTGGCAGAACAGCCTGG + Intronic
1051443996 9:17120923-17120945 AGGCTATGGCCAGAACAACATGG + Intergenic
1051524925 9:18032416-18032438 AGGCTATTGGCAAAACATCCGGG + Intergenic
1053473221 9:38361556-38361578 AGGGTCTGGGCAGGACACCCAGG - Intergenic
1053486172 9:38458186-38458208 AGGCTCAGTACAGAACATTCTGG + Intergenic
1055084412 9:72299489-72299511 AGGCACTAGGCAGAGCACCCTGG + Intergenic
1055173026 9:73284161-73284183 AGCCTCTGAGCAGAACAGCCTGG + Intergenic
1055993430 9:82131587-82131609 AGTCTCCGTGCAGAAGATCCAGG + Intergenic
1057727321 9:97577129-97577151 AGTCTCTGGGCAGCAGAGCCAGG - Intronic
1060411407 9:123402869-123402891 AGGTGCTGGGCATAACACCCAGG + Intronic
1061864698 9:133486118-133486140 AGGCTCTCAGCCCAACATCCGGG - Intergenic
1203518793 Un_GL000213v1:27729-27751 ATGCACTGGGCAGTACAGCCTGG - Intergenic
1186484640 X:9924632-9924654 AGGCACGGGGCACCACATCCAGG + Intronic
1189115308 X:38336125-38336147 AGGCATTGTGCAGAAGATCCAGG + Intronic
1191058920 X:56273827-56273849 AGCCTCTGGGCAAAACAACTAGG - Intronic
1191743701 X:64463736-64463758 ACTCTCTGGACAGAGCATCCAGG - Intergenic
1192226546 X:69232094-69232116 AAGCTCTGGGCTGGAAATCCTGG + Intergenic