ID: 1080870308

View in Genome Browser
Species Human (GRCh38)
Location 11:36230919-36230941
Sequence ACATAGAGACTATACACGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080870308_1080870311 23 Left 1080870308 11:36230919-36230941 CCCTCCGTGTATAGTCTCTATGT 0: 1
1: 0
2: 2
3: 2
4: 69
Right 1080870311 11:36230965-36230987 CTCTGTGTCCAGTCAGCCACAGG 0: 1
1: 0
2: 0
3: 18
4: 220
1080870308_1080870312 24 Left 1080870308 11:36230919-36230941 CCCTCCGTGTATAGTCTCTATGT 0: 1
1: 0
2: 2
3: 2
4: 69
Right 1080870312 11:36230966-36230988 TCTGTGTCCAGTCAGCCACAGGG 0: 1
1: 0
2: 2
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080870308 Original CRISPR ACATAGAGACTATACACGGA GGG (reversed) Exonic
909830004 1:80175905-80175927 ACATAGAGGCTGTACAAGGCAGG + Intergenic
910411529 1:86951211-86951233 ACATTGAGACTATGCATGGTGGG - Intronic
912331207 1:108821701-108821723 AAATAGAGTCTAAACACAGAAGG + Intronic
918182925 1:182100788-182100810 ACATGGAGTCTATAAACAGAAGG - Intergenic
1073689554 10:105792724-105792746 ACACAGAGACTAGAAATGGAAGG + Intergenic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1082600901 11:55152417-55152439 ACATAAAAGCTAGACACGGACGG - Intergenic
1086351160 11:85943997-85944019 CCATACAGACAATACAAGGAGGG - Intergenic
1087118691 11:94550182-94550204 AGCTAGAGACAATACATGGAGGG - Intronic
1090842524 11:130504579-130504601 ACAGAGAGACTAAAAACAGAGGG - Intergenic
1095066671 12:37786893-37786915 ACATAAAAACTAGACACAGAGGG + Intergenic
1106789676 13:33141975-33141997 ACATGGAGAATACACATGGATGG + Intronic
1107062516 13:36174975-36174997 AAATGGAGACTATATAGGGAGGG - Intronic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1112841757 13:103587988-103588010 AAATAGAAAGTAGACACGGAAGG + Intergenic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1121659439 14:95624120-95624142 ACATTGAGACCATAGCCGGAGGG + Intergenic
1122191184 14:100044998-100045020 GCATAGAGACAATAAAAGGAGGG + Intronic
1123192456 14:106584350-106584372 ACAGAGAGAATATAGACAGAAGG + Intergenic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1125737565 15:41938007-41938029 TCATAGACACCATACACAGATGG + Intronic
1126644083 15:50857699-50857721 ACATGGAGACTATTCAAGGCAGG + Intergenic
1130227518 15:82071148-82071170 ACTTAGAGACTGTCCACGGAGGG - Intergenic
1131138099 15:89953975-89953997 ACATAGAGACTATTCTTAGAGGG + Intergenic
1137039153 16:35593614-35593636 ACATAGAGAAAATAGATGGAAGG + Intergenic
1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG + Intergenic
1138761020 16:59544268-59544290 AAATAGATACTATACATGCATGG - Intergenic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1156871380 18:41949592-41949614 ACATAGAAAACATACACAGAGGG + Intergenic
927287334 2:21370076-21370098 ACATAGACACTAGACATGAAAGG - Intergenic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
935785113 2:106541646-106541668 AAATAGAGACCATACAAGGTGGG + Intergenic
937611241 2:123864140-123864162 ACATAGGGACTGTACACTTAAGG - Intergenic
947336318 2:229088616-229088638 AAATAGAGACTAAATACAGATGG + Intronic
1177966350 21:27732308-27732330 ACAAACACACTATACACTGAAGG - Intergenic
952042315 3:29275905-29275927 ACATAAAGATTATACATGAATGG + Intergenic
963758635 3:149261865-149261887 ACATAAAGACTAAACATGAAGGG + Intergenic
963775948 3:149440271-149440293 ACAGAGAGAGTATTCATGGAGGG - Intergenic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
968091412 3:195900555-195900577 ACAAAGAGACAGTACACTGAGGG + Intronic
974516970 4:62928614-62928636 AAATAGAGACCAAATACGGATGG - Intergenic
976613924 4:87057169-87057191 ACATAGAAGCAAGACACGGAGGG + Intronic
978233432 4:106428729-106428751 ACATAAAATGTATACACGGAAGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
985172499 4:187167073-187167095 AAATTGAGACTATACAGGCATGG - Intergenic
987747428 5:21994267-21994289 AAATAGAGACTACACACAAAGGG + Intronic
990308450 5:54516724-54516746 ACATAGAGACAACAGATGGATGG + Intergenic
991079061 5:62575771-62575793 ACATAGTAACTATACACAGTGGG - Intronic
991767602 5:70004060-70004082 AAATAGAGACTACACACAAAGGG + Intergenic
991846836 5:70879136-70879158 AAATAGAGACTACACACAAAGGG + Intergenic
1003184438 6:3818647-3818669 ACAGACAGACTATTCATGGAGGG + Intergenic
1011533016 6:88345422-88345444 ACATAGAGACATTTCACAGATGG - Intergenic
1012264319 6:97122700-97122722 GCATAGAGACAATCCACAGAGGG - Intronic
1012523921 6:100154632-100154654 CCATAGTGACTATACATAGAAGG - Intergenic
1023213921 7:37840276-37840298 ACAAAGATACTAGAGACGGAGGG + Intronic
1024554375 7:50590945-50590967 AGAGAGAGATTATACACTGATGG + Exonic
1028447587 7:90942644-90942666 ACATAGAGACTGCACAATGAAGG - Intronic
1035011251 7:155717355-155717377 ACATAGACAGTACACACAGAGGG - Intronic
1035692066 8:1566704-1566726 GGATAGAGACAATACAGGGAGGG - Intronic
1039820292 8:41128663-41128685 ACCTAGAAACTAGACACGAAGGG + Intergenic
1040968240 8:53106163-53106185 ACATACAGAATATACAGGGAAGG - Intergenic
1040979938 8:53236594-53236616 AGATAGTGACTAAACATGGATGG + Intronic
1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG + Intronic
1044437016 8:92176487-92176509 GCATATAGACTATAAATGGATGG + Intergenic
1046271904 8:111906953-111906975 ACATAAAGACAATAAACAGAAGG - Intergenic
1056981471 9:91315842-91315864 ACACACAGACTTTACAAGGATGG - Intronic
1186017424 X:5213686-5213708 ACATAGACACCACACACAGATGG + Intergenic
1188674483 X:32922248-32922270 ACTTAGAGAGTATACATTGAAGG - Intronic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1196585725 X:117425378-117425400 ACATAGGGAATATACACATACGG - Intergenic
1196585728 X:117425408-117425430 ACATAGGGAATATACACATACGG - Intergenic
1196585731 X:117425438-117425460 ACATAGGGAATATACACATATGG - Intergenic
1202577985 Y:26347534-26347556 ACACAGAAACTATACATGAAAGG + Intergenic