ID: 1080875888

View in Genome Browser
Species Human (GRCh38)
Location 11:36274017-36274039
Sequence CTGCATTAGATGAAGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080875884_1080875888 -1 Left 1080875884 11:36273995-36274017 CCACTTCTTCACCTAGGAGTGGC 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1080875882_1080875888 0 Left 1080875882 11:36273994-36274016 CCCACTTCTTCACCTAGGAGTGG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 274
1080875880_1080875888 9 Left 1080875880 11:36273985-36274007 CCAATTATTCCCACTTCTTCACC 0: 1
1: 0
2: 4
3: 24
4: 284
Right 1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080875888 Original CRISPR CTGCATTAGATGAAGGAAGA GGG Exonic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
902077581 1:13800317-13800339 CTTGATTACATGAAAGAAGATGG + Intronic
902275737 1:15338056-15338078 CTGGAGTAGATGATGGGAGAGGG - Intronic
906149124 1:43577513-43577535 CTGGGTTAGATGGTGGAAGAGGG + Intronic
906782922 1:48588571-48588593 CGGCAGGAGATAAAGGAAGAAGG + Intronic
907019787 1:51055548-51055570 CTACATTAAAAGAAGAAAGAAGG - Intergenic
909937180 1:81565612-81565634 CAGCATGAAATGAAGGAAAATGG - Intronic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
910712443 1:90195863-90195885 CTGCATTAGAGGCAAGAATAAGG - Intergenic
911337885 1:96602984-96603006 CAACATTAAATGAAGGAATATGG + Intergenic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912724063 1:112043383-112043405 CTGCAGGAGGTGGAGGAAGAGGG + Intergenic
913003988 1:114610204-114610226 CATCGTTAGATGAAGGATGAAGG + Intronic
913212227 1:116591093-116591115 CTGCATTTGAAGAAGGGAGAAGG - Intronic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
914946104 1:152067804-152067826 CTCCAAGAGATGAAGAAAGAAGG - Intergenic
915585845 1:156843533-156843555 CAACATCAGAAGAAGGAAGAAGG + Intronic
918816556 1:189192888-189192910 CTGCAGTGGATAAAGGAAGGAGG + Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
921630721 1:217430465-217430487 CTGCATTAAAGTAAGGTAGAGGG + Exonic
921890684 1:220350778-220350800 CTGAATTAAATTAAGGAAAAAGG + Intergenic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1064095990 10:12424869-12424891 CTCTATTAGATGATGCAAGAGGG - Intronic
1064761806 10:18628670-18628692 CTGAATGAAATGAAGCAAGAAGG + Intronic
1069629879 10:69891025-69891047 ATGCATTAAAAGAAGGAAGGTGG - Intronic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1073175632 10:101555153-101555175 TTGCTATAGATGAAGGTAGAGGG + Exonic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076054652 10:127362157-127362179 CTGCATCATATCAAAGAAGATGG - Exonic
1076576208 10:131470965-131470987 CTGCATTAGAAAAACAAAGAGGG - Intergenic
1078499264 11:11853648-11853670 TTTCATTAAATGAAAGAAGAGGG - Intronic
1079331846 11:19540155-19540177 CTGCAGGAGATGAAGGCAGGCGG - Intronic
1080183932 11:29456737-29456759 ATGCATTAGATGAACAAAAAGGG - Intergenic
1080452109 11:32386209-32386231 CTGCAGTAAATAAAGCAAGATGG + Intergenic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1082570683 11:54734849-54734871 CTACTTTTGATGATGGAAGAGGG + Intergenic
1082934246 11:58639896-58639918 CTGTAACAGATGAAGGAAGTGGG - Intergenic
1084589075 11:70079648-70079670 CTGCATGGGAAGAAGGTAGAAGG - Intronic
1085611699 11:77956034-77956056 CTTCATTAGAAGAAGGAATTGGG + Exonic
1086577808 11:88360789-88360811 CTGCATTTGAGCAAGGAAGAAGG + Intergenic
1087711073 11:101553140-101553162 TTGAATCAGATGAAGAAAGAGGG - Intronic
1087820789 11:102709730-102709752 CTGCATTACAGGCAGAAAGAAGG + Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088735039 11:112721663-112721685 CTTCAGCAGATGAAGGCAGAAGG + Intergenic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1091040522 11:132276140-132276162 CTGCATTACATGAATGAACCTGG - Intronic
1091131606 11:133151400-133151422 CTGCTGGAGATGCAGGAAGATGG + Intronic
1092144132 12:6202924-6202946 CTTCATCAGAGGCAGGAAGATGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1094276165 12:28677655-28677677 TCACTTTAGATGAAGGAAGAAGG + Intergenic
1096466593 12:51850134-51850156 CTGCATTAGAAGAAGGGAGGGGG - Intergenic
1098174052 12:67772631-67772653 AAGCATTAGATGGAGGAAGCAGG - Intergenic
1098562239 12:71887665-71887687 CTACATTAGATGGGGAAAGAGGG - Intronic
1098934495 12:76462765-76462787 CTGAATAAGATGAAGGAACCTGG + Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099464913 12:82972348-82972370 GTTTATTAGATGAAGGATGATGG - Intronic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100041112 12:90318299-90318321 CTGCATAAGATGAAGGCTCATGG + Intergenic
1100726315 12:97412664-97412686 CTGCAATAAATGAAAGAAAAGGG + Intergenic
1103569224 12:121833302-121833324 CTGCATTTGAGGGAGGAAAAAGG + Intergenic
1105215474 13:18281716-18281738 CTGCATTTGAAGAAGGGAGAAGG - Intergenic
1105837978 13:24227117-24227139 CTGGGTGAGATGAAGGATGAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106871574 13:34027506-34027528 CTTGATTGGATGAAGGGAGATGG - Intergenic
1107598061 13:41984650-41984672 CTGCATTAGCACAAGGGAGAGGG - Intergenic
1108617891 13:52152883-52152905 ATGCATAAGATGATGGAATATGG - Intronic
1108884277 13:55160038-55160060 CTAAATTAGATGGAGGATGAAGG + Intergenic
1109401218 13:61831195-61831217 CTGAATTAGAGGACAGAAGAAGG - Intergenic
1110316407 13:74113167-74113189 CTGCATAACATAAAGGTAGAAGG + Intronic
1110429047 13:75402021-75402043 TTGCATTAGATGCAGGAGGAAGG - Intronic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1114511066 14:23261526-23261548 CTGCATTAGGTGGAGTTAGATGG + Intronic
1116271601 14:42776636-42776658 GTGCATTCCAGGAAGGAAGAAGG - Intergenic
1116760203 14:49003336-49003358 CTGTCTTAGATGAAAGGAGATGG + Intergenic
1118640330 14:67786235-67786257 TGGAAATAGATGAAGGAAGAGGG + Intronic
1119200093 14:72745941-72745963 CTGCATTTTATGAATGATGAGGG + Intronic
1121054675 14:90842893-90842915 CTGCATGAGATGTGGGCAGAGGG - Intergenic
1121906592 14:97751740-97751762 TTGCATCAAATGAAGAAAGAAGG - Exonic
1122225869 14:100278953-100278975 CTCCACTAGATGGAGGAACAAGG - Exonic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1125311483 15:38383532-38383554 CTGAATTAGAAGAAAGAAGTTGG + Intergenic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1127291065 15:57571704-57571726 CAGCATGAGATAAAGGAAGCAGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129878273 15:78991192-78991214 TAGCATCAGATGAAGGAAGAGGG + Intronic
1130529298 15:84733960-84733982 TTACCTTAGAAGAAGGAAGAAGG + Intergenic
1135791113 16:25396981-25397003 CTGTATTTGAGGCAGGAAGATGG + Intergenic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136785549 16:32932080-32932102 CTGCATGAGAGGGAGGAAGGAGG + Intergenic
1136884224 16:33921724-33921746 CTGCATGAGAAGGAGGAAGGAGG - Intergenic
1138074376 16:54026330-54026352 CTACATTACAGGTAGGAAGAAGG + Intronic
1139238989 16:65371074-65371096 CTGCAACAGATGAAGGACGGAGG - Intergenic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1140726429 16:77817283-77817305 CTGCATGACATGAATGAAGGGGG - Intronic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1141531870 16:84651896-84651918 CTTCTTTAGATGAAGGGAGCTGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146694265 17:34896867-34896889 CTGAATTAGAGGAAGAAAGGTGG - Intergenic
1147145875 17:38484226-38484248 CTGCATGAGAGGGAGGAAGGAGG + Intronic
1147387480 17:40090835-40090857 CTGAATTAGAGAAAAGAAGAGGG - Intronic
1148799177 17:50212340-50212362 CTTCTTTAGATGAAGGGGGAGGG - Intergenic
1149014462 17:51891825-51891847 CTGCACTATAAGCAGGAAGAAGG + Intronic
1149251388 17:54774009-54774031 CTGCAGTAGATGAAAGATCAGGG - Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1150332906 17:64308777-64308799 CTGGAGTAGAGGGAGGAAGAGGG - Intergenic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1153443398 18:5146237-5146259 CTGCATTTCCTGAAGGAAGTGGG - Intronic
1153646145 18:7197758-7197780 ATGGATTGGATGGAGGAAGAGGG + Intergenic
1153837300 18:8975632-8975654 CTTCTTTGGATGAAGAAAGAGGG - Intergenic
1156540122 18:37901423-37901445 CTGCATTGGAAGAAGGAAGGTGG - Intergenic
1157148299 18:45188742-45188764 CTGCCTTAGATGGAGTATGAAGG + Intergenic
1158942855 18:62421741-62421763 CTACAGTAGGTGAAGAAAGAAGG - Intergenic
1159289475 18:66396874-66396896 CTGCTTTAGATGTCGGAAGCAGG + Intergenic
1160340310 18:78083903-78083925 TTGCATTTGCTGCAGGAAGAAGG + Intergenic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1162204327 19:9044413-9044435 CTTCCGTAGAGGAAGGAAGAAGG - Intergenic
1166167213 19:40999990-41000012 CTGCAATAAAGGAAGGGAGAGGG - Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
925831739 2:7903103-7903125 CTGCATAAAAGAAAGGAAGATGG + Intergenic
925880326 2:8346748-8346770 CTGCTTCAGATGGAGGAGGAAGG - Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
926897496 2:17710274-17710296 CTGCAATAGAGAAATGAAGATGG + Intronic
927318078 2:21709168-21709190 AAGCACTAGATGAAGGGAGATGG + Intergenic
929380723 2:41349268-41349290 ATGCATTAGATGTAATAAGAGGG - Intergenic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
929514086 2:42590450-42590472 CTGCATCTGATGAAGGAATCAGG - Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930491169 2:52074503-52074525 CTGCATTAGAAACAGGAAGAAGG + Intergenic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
934298856 2:91765011-91765033 CTGCATTTGAAGAAGGGAGAAGG + Intergenic
935600186 2:104914691-104914713 TTGCTTTAGCTGAAGGAGGAGGG + Intergenic
935937188 2:108199190-108199212 CTTCTTTAGATTAAGGGAGAGGG + Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937376462 2:121339253-121339275 CTGCATTGGATGCAGGAAGCTGG - Exonic
937726145 2:125168636-125168658 CTGGATCTGATGTAGGAAGAGGG + Intergenic
938209982 2:129459245-129459267 CTGGATTAGATCATGGAAGGAGG - Intergenic
940441072 2:153717017-153717039 CTGCTATAGATGAAGTGAGAAGG - Intergenic
941717830 2:168782278-168782300 CAGCATGAGTTGAATGAAGAAGG + Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
945262272 2:207854747-207854769 CTGCATCTGATCAAGGAAGAAGG + Intronic
945296336 2:208174893-208174915 CTCCATTTGATGGAGAAAGAGGG - Intronic
946429846 2:219619702-219619724 ATGCAGTAGATGAGGGAACAAGG - Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
947843032 2:233220866-233220888 CTTCGATAGCTGAAGGAAGAGGG + Intronic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170491333 20:16878450-16878472 CTTCATTGGATGAAGGAGGGTGG - Intergenic
1172754434 20:37273301-37273323 CTGCAGTAGATGGATGAGGAAGG + Intergenic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1175426174 20:58868592-58868614 CTGCCTTAGTTGAAGAAAGGGGG + Intronic
1178419547 21:32432645-32432667 CTGTTTTAGATGAAGGATTACGG - Intronic
1180590262 22:16931197-16931219 CTGCATAAGAGGGAGGAAGGAGG + Intergenic
1181906781 22:26203936-26203958 CTACATTTGATGAGGCAAGAGGG + Intronic
1182930023 22:34164585-34164607 CTGAAATCTATGAAGGAAGAGGG - Intergenic
1183659324 22:39209356-39209378 CTGCATTCAAGGCAGGAAGAAGG + Intergenic
1203236144 22_KI270732v1_random:3130-3152 ATGAATTAAATGAAGGGAGAAGG + Intergenic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
949976799 3:9468103-9468125 AGGCATTGGATGAAGGAACAAGG + Intronic
950840914 3:15967539-15967561 CTGGGTTAGATAAAGCAAGAAGG + Intergenic
951696577 3:25451119-25451141 CTGCCCTAGATTAAGGAAGGTGG + Intronic
953402005 3:42631731-42631753 CTGCTTTGGATGATTGAAGATGG - Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
955323348 3:57990759-57990781 GTGGATTAGAGGAAGGGAGAGGG + Intergenic
955973907 3:64462800-64462822 CAGTATTAGAGGGAGGAAGAGGG - Intergenic
956893104 3:73631940-73631962 GTGATTTAGCTGAAGGAAGAGGG - Intergenic
957231645 3:77525168-77525190 CTGCATTAAATGGATGAAAATGG - Intronic
958271318 3:91502852-91502874 CTCCATTAGATGAAGGAATTTGG - Intergenic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959269594 3:104190772-104190794 CTGCTGTGGATGAAGGAAGTTGG + Intergenic
963631615 3:147738597-147738619 CTTCTTTAGATGAAGGGATATGG - Intergenic
964624746 3:158748330-158748352 CTGCATTCCAGGAAGGAATAAGG - Intronic
967311457 3:188110264-188110286 CAGCATTACAGGAAGGAAGGAGG + Intergenic
968289792 3:197529922-197529944 CTGCTATAGAAGAAGGATGAAGG - Intronic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
969447103 4:7251681-7251703 CTGCATTCCAGGCAGGAAGAAGG + Intronic
971120247 4:23696445-23696467 CTTCTTTAGATGCTGGAAGATGG + Intergenic
971536463 4:27758114-27758136 CTGCATTTGATTAAGAAAAAAGG - Intergenic
971798904 4:31262848-31262870 CAGCAATAAATGAAGAAAGAGGG - Intergenic
972318636 4:37951468-37951490 CTGCATTATAAGAAGGAAGGAGG + Intronic
973656048 4:53048805-53048827 CAGCTTTAGAGGAAGCAAGAAGG - Intronic
973656231 4:53050850-53050872 CAGCTTTAGAGGAAGCAAGAAGG - Intronic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
977696239 4:99969714-99969736 CTGCCAGAGATGAATGAAGAGGG - Intergenic
978137313 4:105277965-105277987 CTGCATAAGATGAATAAACAGGG + Exonic
978565306 4:110074871-110074893 CTCCAGGAGATGAAGGAACAGGG - Intronic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980613490 4:135188060-135188082 CTACAGTTGATGTAGGAAGATGG - Intergenic
981607672 4:146557647-146557669 ATGCATGAAATGAAGCAAGAAGG - Intergenic
982332220 4:154193275-154193297 CTGCATTATTTGAAGGATGAAGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982628474 4:157800043-157800065 GTAAATTAGATGAAGGAAAATGG - Intergenic
983428358 4:167616316-167616338 CTGCAATAGATAAATGAATAAGG - Intergenic
984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG + Intronic
984751624 4:183282817-183282839 GTGCCTGAGATGAATGAAGACGG + Exonic
986121895 5:4847079-4847101 CTGCTTCAAATGAAGGAATAAGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989759217 5:44992140-44992162 AAGCATGGGATGAAGGAAGAGGG - Intergenic
990189826 5:53247241-53247263 AGGAATTAGATCAAGGAAGAAGG - Intergenic
990870837 5:60430363-60430385 CTGGAGTAGAGGGAGGAAGAGGG - Intronic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
993346562 5:86790917-86790939 CTGAAATGGATGAATGAAGAAGG - Intergenic
993514592 5:88814843-88814865 CTGCATGAGGAAAAGGAAGAAGG + Intronic
993826440 5:92692990-92693012 ATGCAATAGAGGAAAGAAGAAGG + Intergenic
994297035 5:98102855-98102877 CTGCAGCAGATGAAGTCAGATGG - Intergenic
994859481 5:105169971-105169993 CTGCTTTAGAGGTAGGACGAAGG + Intergenic
994994887 5:107048221-107048243 TTACTTTAGAGGAAGGAAGAGGG + Intergenic
995726116 5:115181921-115181943 CTGCATTACAAGCAGGAAGGAGG + Intergenic
995734860 5:115289048-115289070 CTGCCTTTGATGAAGGCTGAGGG - Intronic
997211072 5:132077091-132077113 CTGAAGTAGAGGAAGCAAGAGGG - Intergenic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
1000275907 5:159734445-159734467 CAGCTTTGGATGAAGGAAGGTGG + Intergenic
1003731178 6:8826370-8826392 CTTCAGTAAATGGAGGAAGATGG - Intergenic
1004249117 6:14007875-14007897 CTGCAGTGGATGCAGAAAGAGGG - Intergenic
1005702934 6:28421420-28421442 CTTTATTAAATGAAGAAAGAAGG + Intergenic
1006258367 6:32848884-32848906 CAGCATTATGTGAAGCAAGAAGG + Intronic
1008726475 6:54427539-54427561 GTGCATGAGATTAAGGAAAAAGG - Intergenic
1008983819 6:57518458-57518480 CTCCATTAGATGAAGGAATTTGG + Intronic
1009171878 6:60411365-60411387 CTCCATTAGATGAAGGAATTTGG + Intergenic
1009498243 6:64376991-64377013 ATGCATAAGATCCAGGAAGATGG + Intronic
1010380206 6:75215413-75215435 CTGCTTCAGAGGGAGGAAGAGGG + Intergenic
1010507714 6:76680860-76680882 CAGCATGAGATGAAGTAAGTGGG + Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1012111499 6:95241385-95241407 ATGCCTGAAATGAAGGAAGAAGG + Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1013757786 6:113481563-113481585 CTGCAGGAGATGCAGGGAGAAGG - Intergenic
1014107094 6:117578372-117578394 CTGCATTTCAGGCAGGAAGAAGG - Intronic
1014166150 6:118227297-118227319 CTGCAACAGGTGAAGCAAGATGG + Intronic
1015086998 6:129307324-129307346 ATGCATGGGATGAAGGAAAATGG - Intronic
1015167007 6:130209768-130209790 CTGAATTAGATGACGCCAGAGGG - Intronic
1015565577 6:134567134-134567156 CTGCTTTGGATGAAGAGAGAGGG - Intergenic
1017218308 6:151936174-151936196 CATCATTAGATGAATGAAGATGG + Intronic
1017250296 6:152273044-152273066 CTTCATTAGATGAAAGATGATGG + Intronic
1017842698 6:158233979-158234001 CTGAATTAGAGGGAGGAATATGG + Intronic
1020037934 7:4976358-4976380 CTGCATTTGAAAATGGAAGAGGG + Intergenic
1020159767 7:5761059-5761081 CTGCATTTGAAAATGGAAGAGGG - Exonic
1020769087 7:12365043-12365065 GTGCAAAAGATGAAGAAAGATGG + Intronic
1022980361 7:35599876-35599898 CTGCATTAGATGATGTATTAAGG + Intergenic
1023256884 7:38321330-38321352 CTGCTTTATATGAAGGTAGTGGG + Intergenic
1024395520 7:48862309-48862331 CTGCATTCCAAGCAGGAAGAAGG + Intergenic
1024399712 7:48909968-48909990 CTGCATTCCAAGCAGGAAGAAGG - Intergenic
1025841392 7:65153023-65153045 CTTCATTAGAAGAAGGAATTGGG - Intergenic
1025881655 7:65542946-65542968 CTTCATTAGAAGAAGGAATTGGG + Intergenic
1025891786 7:65659686-65659708 CTTCATTAGAAGAAGGAATTGGG - Intergenic
1026116614 7:67501311-67501333 CTGCATTCCAGGCAGGAAGAAGG + Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030183927 7:106740587-106740609 CTGCATTTGAAGAATGAAAAGGG - Intergenic
1030463540 7:109871446-109871468 CTGCATTGGATGGAGTTAGATGG - Intergenic
1030486764 7:110178548-110178570 CTGCATTACATAAAGAAATATGG - Intergenic
1030717508 7:112827360-112827382 ATTCAAAAGATGAAGGAAGAGGG - Intronic
1030993917 7:116335036-116335058 CTCCACTAGCTGAAGTAAGAGGG - Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1032134700 7:129265249-129265271 CAGCATTATATGAAGCAAGAAGG + Intronic
1032673398 7:134106533-134106555 CTGCATTTGATACAGGAGGAGGG - Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033650179 7:143335996-143336018 CGTCATGAGATTAAGGAAGATGG - Intronic
1036209327 8:6829262-6829284 CAGCATGAGATGACAGAAGAAGG - Intronic
1037819412 8:22128563-22128585 CTGCCTAAGCTGAAGGCAGAGGG + Exonic
1038318436 8:26507769-26507791 CTTCATTAGCTCAAGGAAGCTGG + Exonic
1040466022 8:47695903-47695925 ATACAATAGATGAAGGAAGCAGG - Intronic
1041476840 8:58276877-58276899 CTCCATTTGATAGAGGAAGAGGG - Intergenic
1044550538 8:93507293-93507315 CTTCATCAGATGAAGGAAAAGGG + Intergenic
1046146629 8:110169980-110170002 ATGCAGTAGATACAGGAAGAAGG - Intergenic
1046524565 8:115367846-115367868 CTGCCTTAGAGAATGGAAGAGGG + Intergenic
1047416633 8:124669828-124669850 CTACACTAGATAAAGGCAGATGG + Intronic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1048928570 8:139292403-139292425 CAGAAATGGATGAAGGAAGAAGG - Intergenic
1055364869 9:75532402-75532424 CTGCATTACATGAAAGGAAATGG + Intergenic
1056673685 9:88654650-88654672 CTGCATTCCAAGCAGGAAGACGG - Intergenic
1059472463 9:114516401-114516423 CTCCAATAGAGGAAGGTAGATGG + Intergenic
1060955046 9:127632794-127632816 CTGCATTCCAGGAAGGAAGGAGG + Intronic
1061252452 9:129434506-129434528 CTGCATTCTATGATAGAAGAAGG + Intergenic
1061589624 9:131590077-131590099 GTGCTTTACATGCAGGAAGATGG - Intronic
1187948215 X:24447091-24447113 CTGCAGTGGATGAAAGAATAGGG + Intergenic
1189209167 X:39268654-39268676 CTGTAATAGATGAAGTAATATGG - Intergenic
1192390499 X:70721843-70721865 CTGAATTAGATGAAGACAGGTGG + Intronic
1193078870 X:77384165-77384187 CTTCATCAAATGAAGGAATAAGG + Intergenic
1193244249 X:79210416-79210438 ATGAATGAGATGAAGCAAGAAGG - Intergenic
1194236677 X:91392856-91392878 CTGAATCTGATGATGGAAGAAGG + Intergenic
1194494600 X:94597761-94597783 CTGCATTAATCGAATGAAGAGGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195583584 X:106535994-106536016 CTGGCTTTGATGATGGAAGAAGG + Intergenic
1197619737 X:128734145-128734167 CTGAATGAAATGAAGCAAGAAGG + Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic