ID: 1080876484

View in Genome Browser
Species Human (GRCh38)
Location 11:36279489-36279511
Sequence TAACCTTCCACCAGTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080876483_1080876484 -5 Left 1080876483 11:36279471-36279493 CCGGAAGTGAAGGGAAGTTAACC 0: 1
1: 0
2: 1
3: 15
4: 132
Right 1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 142
1080876482_1080876484 -4 Left 1080876482 11:36279470-36279492 CCCGGAAGTGAAGGGAAGTTAAC 0: 1
1: 0
2: 3
3: 25
4: 197
Right 1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 142
1080876479_1080876484 6 Left 1080876479 11:36279460-36279482 CCTGACACAACCCGGAAGTGAAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080876484 Original CRISPR TAACCTTCCACCAGTGAGAG TGG Intronic
902343190 1:15797997-15798019 TGACCTTCACCCAGTGTGAGTGG + Intergenic
911120751 1:94293909-94293931 TAACCTTCTAACTGGGAGAGGGG - Intergenic
911849535 1:102799677-102799699 TGACATTTCACTAGTGAGAGAGG - Intergenic
915191820 1:154157248-154157270 TCACCTTCCAAAAGTGAGAAAGG + Intronic
915597379 1:156903349-156903371 GAACTTTCCAACAGTCAGAGCGG - Intronic
915770407 1:158416441-158416463 GAACCTTCCAGGAGTGGGAGTGG - Intergenic
919293869 1:195669116-195669138 TCACCTCACACCAGTTAGAGTGG - Intergenic
920254912 1:204648250-204648272 GCACCTTCCCACAGTGAGAGAGG + Intronic
922447451 1:225709335-225709357 TAACCTTCCAAAACTGAGGGAGG + Intergenic
923036795 1:230290152-230290174 TAAACTTCCACCAGGCACAGTGG - Intergenic
923421513 1:233820560-233820582 TAACCTTCCACCTGTCAGGATGG - Intergenic
1062852951 10:759608-759630 TAAGCTTCCACCAGTGAAGGGGG + Intergenic
1067581215 10:47447293-47447315 TAACCTGCCACAAGTGAGTTGGG + Intergenic
1067985849 10:51143660-51143682 TAACCTTACACCTGTTAGAATGG - Intronic
1068181412 10:53523565-53523587 TATATTTCCACCAGTCAGAGGGG + Intergenic
1068882365 10:62064067-62064089 TCTCCTGCCACCAGTGAGACAGG + Intronic
1070468288 10:76748326-76748348 TCACCTTACACCAGTCAGAATGG + Intergenic
1073118177 10:101104695-101104717 TAACAGTCCACCAGTGGGAATGG - Intronic
1076700642 10:132270963-132270985 TCACCTCCCACCAATCAGAGGGG + Intronic
1079889593 11:26034269-26034291 TCATCTTCCACCAGTCAGAGTGG - Intergenic
1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG + Intronic
1081931463 11:46874306-46874328 TGTCCTGCCACCAGTAAGAGTGG - Intronic
1082210813 11:49498828-49498850 TGTCTCTCCACCAGTGAGAGTGG - Intergenic
1083161043 11:60854284-60854306 TAACCAGCCACCACTGAGTGCGG - Intronic
1083216250 11:61222164-61222186 TAACCTTGCACCATGGGGAGGGG - Intergenic
1083219132 11:61240990-61241012 TAACCTTGCACCATGGGGAGGGG - Intergenic
1084644861 11:70450503-70450525 TAGCCTTCCAGCAGTAAGTGGGG + Intergenic
1088545874 11:110958250-110958272 TCACCTTACACCTGTGAGAGTGG + Intergenic
1089310796 11:117556956-117556978 TAGCATCTCACCAGTGAGAGGGG + Intronic
1092384091 12:8022228-8022250 AAACCTTCCACCAGAAAGACAGG - Intergenic
1094213648 12:27918745-27918767 CACCCTTCCACTGGTGAGAGGGG + Intergenic
1094231375 12:28107913-28107935 TCATCTTCCACCAGTCAGAAAGG + Intergenic
1094883580 12:34834137-34834159 GAACCTTCCATCAGACAGAGCGG - Intergenic
1098727841 12:73991091-73991113 TATCATTCCACCAGTCACAGAGG - Intergenic
1099290676 12:80772738-80772760 TAATCTTACACCAGTCAGAATGG - Intergenic
1108514554 13:51188173-51188195 TAGCCTTCAACCATTCAGAGTGG - Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1116057086 14:39876989-39877011 GAACCTTTGACCAGTGAGAGAGG - Intergenic
1117711752 14:58537570-58537592 TAAACTTCCAAGAGTTAGAGAGG - Intronic
1120131673 14:80815368-80815390 TCACCTTACACCAGTCAGAATGG + Intronic
1121780905 14:96621984-96622006 TAACCATCCAGCAGAGAGAAAGG + Intergenic
1125158298 15:36614569-36614591 TCACCTTCCAAAAGTGAGAAAGG - Intronic
1126024726 15:44434972-44434994 TAACCTTCGACCAGACACAGTGG + Intronic
1127255046 15:57283172-57283194 TAAAATTCCACCAGAGAGAAGGG - Intronic
1127767810 15:62204587-62204609 TCACCTTACACCAGTCAGAATGG - Intergenic
1129232300 15:74203478-74203500 TAAACCTCCACCAGGGACAGTGG - Intronic
1132064237 15:98717236-98717258 TCACCTTCCTTCAGTGAGACAGG + Intronic
1133850642 16:9500170-9500192 CAACCTGCCAGCAGTGAGGGAGG - Intergenic
1137764167 16:50964923-50964945 TAACCTTCAGCTAGTGAGACAGG - Intergenic
1137885306 16:52096447-52096469 TAATCTTCAACCAGTGAAAGGGG - Intergenic
1137938270 16:52656419-52656441 TCACCTTCCAAAAGTGAGAAAGG - Intergenic
1143039877 17:4026213-4026235 TGTCTTTCCAACAGTGAGAGTGG + Intronic
1143147605 17:4786732-4786754 AAACATTCCAGCAGTGAGAGTGG + Intergenic
1144585994 17:16488131-16488153 TAACCTTCCGCCATTGAGAGAGG - Intronic
1145254500 17:21315275-21315297 CAACCTTCCCCAAGTAAGAGGGG - Intergenic
1147452123 17:40512241-40512263 CACCCTCCCACCAGTGAGTGGGG - Intergenic
1152388496 17:79989324-79989346 GAACCAACCACCAGTGAGAGGGG - Intronic
1153242469 18:3043283-3043305 TAACTTTCCCACAGTGAGAAAGG + Intergenic
1156321452 18:36028921-36028943 TACCCTTTCATCAGGGAGAGCGG + Intronic
1160192861 18:76729055-76729077 TGACATTCCACCAGTTTGAGTGG + Intergenic
1160450712 18:78964752-78964774 TGACCGTCCTCCAGTGAAAGGGG - Intergenic
1161393730 19:4034080-4034102 GAGCCTTCCACCAGGGAGAAAGG - Intronic
1162423499 19:10579803-10579825 TAAAATTCCACCAGTGCGTGCGG - Exonic
1165765780 19:38350137-38350159 TGACATTCCACTAGTGAGAAGGG + Intronic
1166243078 19:41507280-41507302 TCACCTTCCAAAAGTGAGAAAGG - Intergenic
927551907 2:24008856-24008878 ATACCTTCCACCAGTAACAGGGG - Intergenic
931282651 2:60807765-60807787 TAACTTTCTACCAGTCTGAGAGG - Intergenic
931798651 2:65736804-65736826 AAATCTTCCCCCAGTGTGAGTGG + Intergenic
932400601 2:71478679-71478701 AAACCTCCCTCCAGGGAGAGGGG - Intronic
933997015 2:87677457-87677479 AATCCTGACACCAGTGAGAGGGG - Intergenic
934102509 2:88666566-88666588 TAACCTTACCCCAGTGAGGATGG + Intergenic
935132456 2:100270849-100270871 CCACCTACCACCAGTGATAGGGG + Intergenic
935899426 2:107774957-107774979 TAATTTTCCACCAGTTATAGGGG - Intergenic
936296834 2:111273453-111273475 AATCCTGACACCAGTGAGAGGGG + Intergenic
939205152 2:139092697-139092719 TAACCTCACACCAGTCAGAATGG + Intergenic
941420954 2:165282258-165282280 TGACCTTCCACCAGTTTGGGTGG + Intronic
943849046 2:192692701-192692723 CCATCTTACACCAGTGAGAGCGG + Intergenic
943924328 2:193752679-193752701 TTACCTTACACCAGTCAGAATGG - Intergenic
947488351 2:230572774-230572796 TCACCTTCCAAAAGTGAGAAAGG + Intergenic
948927240 2:241107189-241107211 TGACCTGTCACCTGTGAGAGGGG - Intronic
1168813225 20:719873-719895 TGACCTTTCACCAGGGTGAGTGG + Intergenic
1173141843 20:40491617-40491639 AATCCTGCCACCAGTGAGTGGGG - Intergenic
1179271308 21:39853265-39853287 TAACCATCCCCCAGAGAGACAGG + Intergenic
1181622586 22:24101128-24101150 TAACTTTCCAGCAGTGGGAGAGG + Intronic
1182829264 22:33291442-33291464 TAAGCACGCACCAGTGAGAGAGG - Intronic
950872667 3:16243095-16243117 TAACCCTCAACCAATAAGAGAGG - Intergenic
951077908 3:18419314-18419336 TAACCTTCCAGCATTTAAAGGGG + Intronic
952519038 3:34136684-34136706 CCATCTTCCACCAGTGAGAATGG + Intergenic
953955317 3:47227493-47227515 TATTCTTCCAACAGTGGGAGAGG - Intergenic
957702108 3:83727536-83727558 AAAGCTTGCAGCAGTGAGAGGGG - Intergenic
963019038 3:140854366-140854388 TTACCTTCATCCTGTGAGAGGGG - Intergenic
963902960 3:150749889-150749911 TTACCTTGGACCACTGAGAGTGG - Intronic
964272249 3:154969752-154969774 TGTCCTTCCACCACTTAGAGTGG + Intergenic
965147439 3:164924664-164924686 TAATCTCCCAACAGTGAAAGAGG - Intergenic
968823149 4:2871664-2871686 TAACCTTCATCCAGTGTCAGTGG + Intronic
968972659 4:3804026-3804048 TCACCCTCCACCCCTGAGAGGGG + Intergenic
973787975 4:54351928-54351950 TAGTGTTCCACCAGGGAGAGAGG - Intergenic
974470847 4:62316028-62316050 TAACCTGCCACCAGTCTGGGAGG + Intergenic
977139161 4:93345335-93345357 TCACTTTGCACCAGAGAGAGTGG - Intronic
977324403 4:95556410-95556432 TAAGCTACCATCAGTGAGAGAGG - Intergenic
979528851 4:121746352-121746374 TAATCTCACACCAGTGAGAATGG - Intergenic
981165012 4:141547528-141547550 CAACCTTCCACCACTGAAATAGG + Intergenic
983146345 4:164219574-164219596 TAACATTTCATCAGTGAGATTGG - Intronic
985220003 4:187694036-187694058 TAACCGTCCAACATTGAGACAGG + Intergenic
986086488 5:4456574-4456596 TAACCTCACACTAGTGAGTGGGG + Intergenic
989304057 5:39931246-39931268 TAGCCTTCCAACAAGGAGAGTGG + Intergenic
989631966 5:43494553-43494575 TAACCTTCCTCCAGATAGACCGG - Exonic
990103288 5:52220553-52220575 TTATCTTGCACCAGTGAGAATGG - Intergenic
990186929 5:53219782-53219804 TAACCCTTCACCTGTGAGAGAGG + Intergenic
990791282 5:59483045-59483067 GAACCTTCCACAAGTAAGAGAGG + Intronic
992026703 5:72677070-72677092 TCACCTTCTACCAGTCAGAATGG - Intergenic
1004384401 6:15159897-15159919 TGACCTTCCTCCACTGAGACAGG - Intergenic
1004530710 6:16452616-16452638 AAATCTCACACCAGTGAGAGTGG - Intronic
1005601107 6:27426863-27426885 TAACATTTCACCAGTCAGATAGG + Intergenic
1008626105 6:53318065-53318087 TAACCTTGGACAAGTGACAGTGG - Intronic
1010269082 6:73901014-73901036 TACCCTTCCACTGGGGAGAGTGG - Intergenic
1012099518 6:95013116-95013138 TCACCTTACACCTGTGAGAATGG - Intergenic
1017869527 6:158475146-158475168 TCACCTCCCACCAGGGAGTGTGG - Intronic
1020281769 7:6653511-6653533 GTACCCTCCACCAGGGAGAGCGG - Exonic
1020544980 7:9516656-9516678 TAAACTTCAAACAGTGATAGTGG - Intergenic
1022972050 7:35527517-35527539 AAACCTGACAGCAGTGAGAGAGG + Intergenic
1027662835 7:81007891-81007913 TACCCTTCCACCTGTCAGACAGG + Intergenic
1027973816 7:85122548-85122570 TAGGCTTCTACCAGTGAAAGTGG - Intronic
1028169152 7:87574851-87574873 TGACCTCACACCAGTGGGAGTGG - Intronic
1028859717 7:95635125-95635147 TGACCTTCCAACACTGAGAAAGG + Intergenic
1029380864 7:100213747-100213769 TACTCTTCCACCAGTGAGCGCGG + Exonic
1029794464 7:102879384-102879406 CAACCTTCCACCTATAAGAGGGG + Intronic
1030148595 7:106380564-106380586 TTTCCTCCCACCAGAGAGAGGGG - Intergenic
1032592618 7:133206157-133206179 TAACCTTTCAACAGAAAGAGAGG + Intergenic
1034896146 7:154877757-154877779 GAACCTGCCACCAGTGAGACAGG + Intronic
1035024604 7:155817564-155817586 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035024632 7:155817663-155817685 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035024661 7:155817762-155817784 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036467279 8:9012235-9012257 AAACTTTCCACCAGAGAGAGAGG - Intronic
1038690556 8:29758713-29758735 TAACTTTACACCTGTTAGAGTGG - Intergenic
1041472540 8:58226336-58226358 TAATCTTGCCCCAGTGAGAGGGG + Intergenic
1041705725 8:60844369-60844391 GAACCTTTCACCAGTGACTGTGG + Intronic
1042709126 8:71695566-71695588 TAGCCATCCTCCAATGAGAGGGG + Intergenic
1044505244 8:93009283-93009305 TTACCTTACTCCAGTTAGAGTGG + Intronic
1047329203 8:123870762-123870784 GAACCTTACAGCAGTAAGAGTGG + Intronic
1048411567 8:134179946-134179968 GTACCTTCCACCAGAGGGAGAGG + Intergenic
1048599424 8:135903676-135903698 TTACCTTTCAAAAGTGAGAGCGG - Intergenic
1050162255 9:2731009-2731031 TAATCCACCAACAGTGAGAGTGG - Intronic
1052215763 9:25964086-25964108 TATTCTACCACCAGTTAGAGTGG - Intergenic
1052393660 9:27911420-27911442 TAACCTCCCATCAGAGAGGGTGG + Intergenic
1053350568 9:37411030-37411052 CAACCCTCCACCAGAGGGAGCGG - Intergenic
1055042264 9:71887166-71887188 GTACTTTCCACCAGTGAGAAAGG - Intronic
1055210799 9:73788479-73788501 TACCCTTACACCAGTTAGAATGG + Intergenic
1188246301 X:27840031-27840053 TACCCTTCCACCATTGAGGTTGG + Intergenic
1188755559 X:33956776-33956798 AAAGCTTGTACCAGTGAGAGAGG - Intergenic
1189741339 X:44120002-44120024 TTACATTCTACCAGTGAAAGAGG - Intergenic
1192792219 X:74394037-74394059 CCACCTTACACCAGTGAGAATGG + Intergenic
1192893191 X:75412077-75412099 TCACCTTCCACCAGTTAGGATGG + Intronic
1193857092 X:86616456-86616478 CAACCTTACACCAGTCAGAATGG - Intronic
1195010332 X:100727476-100727498 TACCCTTTCACCATTGCGAGTGG - Intronic
1196034598 X:111130438-111130460 TAATATTCCACCAGAGAGAATGG + Intronic
1197533932 X:127664000-127664022 TGCCCTTGCACCAGTGGGAGTGG - Intergenic
1199244143 X:145583324-145583346 TAACCTTCCACCTCTGAGGGTGG - Intergenic
1200022687 X:153225510-153225532 AAACCTTTCAGCAGTGAGACTGG + Intergenic
1200743150 Y:6877208-6877230 GAGCCTACCACCAGGGAGAGGGG - Intergenic