ID: 1080881486

View in Genome Browser
Species Human (GRCh38)
Location 11:36325361-36325383
Sequence TAGCAAACGGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 2, 2: 73, 3: 120, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080881476_1080881486 24 Left 1080881476 11:36325314-36325336 CCCTGCTGGATCTGGAGGGTTGG 0: 2
1: 30
2: 84
3: 144
4: 321
Right 1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG 0: 1
1: 2
2: 73
3: 120
4: 170
1080881478_1080881486 23 Left 1080881478 11:36325315-36325337 CCTGCTGGATCTGGAGGGTTGGA 0: 2
1: 26
2: 69
3: 152
4: 289
Right 1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG 0: 1
1: 2
2: 73
3: 120
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080881486 Original CRISPR TAGCAAACGGCAGTGGTGGA CGG Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
914815259 1:151058361-151058383 TAGCGCAGGGCAGTGGGGGATGG + Exonic
916961565 1:169894249-169894271 TAGCAAACAGTAGAGGTGCAGGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917525175 1:175782040-175782062 GAGAAAAAGGCAGTGGGGGAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1064346438 10:14536984-14537006 TAGAAAATGGCAGAGGAGGAGGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065551428 10:26871817-26871839 TATCAAATGGCATTGGTTGAGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070400944 10:76053090-76053112 TATCAAACAGCAATGGTTGAAGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075466028 10:122650771-122650793 TAGAAATCTGCAGTGGTGCATGG - Intergenic
1075758502 10:124836415-124836437 AATCAAATGGCAGTGGTGTAAGG - Exonic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078101353 11:8332157-8332179 TAGAACAGGGCAGTGGTGGCTGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080874674 11:36264910-36264932 TAGCAAAAGGCAGTGGCTGGTGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1082044057 11:47710606-47710628 TTGCAAAGGGCTGTGGTGGTGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086327777 11:85722030-85722052 AAGCAAACTGCAGTGGGGGTGGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088790371 11:113220356-113220378 TACCAAATGGAAGTGGTTGAGGG - Intronic
1088819659 11:113446539-113446561 TAGGAAGTGGCAGTGGAGGATGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1090184110 11:124725190-124725212 TAGCAGACGGAAGTGGCTGATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097616448 12:61889883-61889905 TAGAAAAAGTCAGTGGTTGATGG - Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1106606661 13:31235030-31235052 TCTCAAACTGCTGTGGTGGAGGG - Intronic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115232242 14:31173598-31173620 TTGGAATCTGCAGTGGTGGATGG + Exonic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119199560 14:72742517-72742539 GAGCACACGGCAGAGGGGGAAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121556390 14:94840973-94840995 TACCAAATGACAGAGGTGGAAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129236630 15:74227596-74227618 TAGCCAACAGCAGTGGTTCAGGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131046912 15:89322276-89322298 TAGGAAGAGGCATTGGTGGAAGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134842755 16:17414794-17414816 GAGCAAACGGCAGTTGAGGGTGG - Intronic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1138212921 16:55178351-55178373 TAGGATATGGCAGTGGAGGAAGG - Intergenic
1138418708 16:56885972-56885994 TAGCAGAGGGCAGTGGTCAAGGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153732665 18:8029940-8029962 TAGCAAAAGGCTGCGGTGCACGG - Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164509503 19:28885847-28885869 AAGCAAATGGCAGTGGAGAAGGG - Intergenic
1165467846 19:35985724-35985746 TAGAAAAGGGCAATGGAGGAAGG - Intergenic
1167066073 19:47187001-47187023 TAGCATAGGGTAGGGGTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
929824043 2:45296187-45296209 AAGGAAAGGGCAGAGGTGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937352286 2:121173635-121173657 TAGGATATGGCAGTGGGGGAAGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
938645375 2:133325124-133325146 TTGAATACGGCAGTGATGGAAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943345946 2:186737132-186737154 TAGGGAATGGCAGAGGTGGATGG + Intronic
944358131 2:198818233-198818255 TAGCAAAAGGCAGTTATGGTAGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
946759829 2:222982657-222982679 TCGCAAATGGGAGTGGGGGAAGG - Intergenic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1170961361 20:21028599-21028621 TAGCAAATGGCAGCAGTGGGAGG - Intergenic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174216484 20:48920552-48920574 TAGGAAATGGAAGGGGTGGAGGG - Intergenic
1174772801 20:53317083-53317105 TAGCAAAAGGCAGTGGTCCAAGG + Intronic
1175283490 20:57820984-57821006 TTGCAGAGGGCAGGGGTGGAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179613634 21:42567881-42567903 TAGCAAACGCCAGGGGAAGAAGG - Intronic
1179666092 21:42913544-42913566 GAGCACAGGGCACTGGTGGAGGG + Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1183313224 22:37122978-37123000 TATCAACAGGCAGTGGGGGAGGG - Intergenic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
1184791703 22:46704029-46704051 TAGCAAATGCCACTGGGGGAGGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962952957 3:140236562-140236584 TAGAAAACGGGAGTGGAGGCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
964626606 3:158765802-158765824 TAGCAAAAGGCAGAGCTGCAGGG + Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971381656 4:26104119-26104141 TAGGAAATGGCAGAGCTGGAAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978241395 4:106520976-106520998 TAGGAACCTGCTGTGGTGGAGGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982225912 4:153166446-153166468 TCCCAAAAGGCAGTGCTGGAAGG + Intronic
982756827 4:159230175-159230197 TAGGAAAAGGTGGTGGTGGAAGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991860828 5:71011539-71011561 TAGAGCACGGCTGTGGTGGAGGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994511817 5:100713542-100713564 TAGAAAATGGCAGTGGTTGCAGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995842752 5:116459428-116459450 TAGCAACAGGAAGTGGAGGATGG - Intronic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
1001079466 5:168656519-168656541 TAGCAAACTGCAGAGCTGGGTGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005282338 6:24287294-24287316 GAGCAAATGGCAGGGGAGGAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005362146 6:25041012-25041034 TAGCAATAGGCAGTGGTAGAGGG - Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006511123 6:34521709-34521731 CAGGCAACGGCGGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012353367 6:98281290-98281312 TAGCAAGGGGTAGTGGTGAATGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023169592 7:37377751-37377773 TAGCAAACAGCCTTGGAGGAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031127449 7:117791199-117791221 GAGCAAAAGGCAATGGTGGTAGG + Exonic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1035664994 8:1374202-1374224 TTGCAGAAGGCTGTGGTGGAGGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043484194 8:80682714-80682736 TGCCAAACGGCGGTGGGGGAGGG + Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045264611 8:100608716-100608738 TAGGAAACGAAAGAGGTGGAGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057051483 9:91927486-91927508 TAGCAAATGGAGGTGGTGAATGG - Intronic
1058560648 9:106225543-106225565 TAGCAAACTACATTGGAGGATGG + Intergenic
1060306806 9:122421067-122421089 TAGCTAATGGCAGTCATGGAGGG - Intergenic
1062011836 9:134271447-134271469 TAGAAAATGGCAGAGGTGAAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192282216 X:69699064-69699086 TAGGAAAAGGCAGTGGCGGAGGG + Intronic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193010473 X:76669818-76669840 TAGCAAACTGCAGTACTGGAGGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198731391 X:139733953-139733975 TAGCAACCGGCAGTGGGGTGGGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic