ID: 1080886783

View in Genome Browser
Species Human (GRCh38)
Location 11:36375325-36375347
Sequence CAGAAGCCCTAGAATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080886783_1080886785 11 Left 1080886783 11:36375325-36375347 CCTTCATCATTCTAGGGCTTCTG 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1080886785 11:36375359-36375381 TTAGCTTTACCTAATATCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080886783 Original CRISPR CAGAAGCCCTAGAATGATGA AGG (reversed) Intronic
901298701 1:8182256-8182278 CCGCAGCCCTAGAAAGAGGAGGG - Intergenic
901597024 1:10393361-10393383 ATGGAGCACTAGAATGATGAAGG + Intergenic
901976880 1:12952265-12952287 CTGAAGTTCTAGAATGATGCAGG - Intronic
902008290 1:13249505-13249527 CTGAAGTTCTAGAATGATGCAGG + Intergenic
902038577 1:13475634-13475656 CAGAAGCCCAGGAAGGATGGAGG - Exonic
908729359 1:67209582-67209604 GAGAGGCCTCAGAATGATGATGG - Intronic
908919153 1:69169310-69169332 CAGAAGCCTCAGAATCATGGTGG - Intergenic
911242251 1:95479291-95479313 CAGAAGCCTCATAATGATGGTGG - Intergenic
913672453 1:121110546-121110568 CAGAAGCCCTGTGATGAGGATGG - Intergenic
914024217 1:143897910-143897932 CAGAAGCCCTGTGATGAGGATGG - Intergenic
914662710 1:149805937-149805959 CAGAAGCCCTGTGATGAGGATGG - Intronic
915095824 1:153461365-153461387 CAGAAGCCCTGGAATTAGGTGGG + Intergenic
915269655 1:154744702-154744724 CACATGCCCTAGCATGCTGAAGG - Intronic
917415969 1:174809571-174809593 CAGATGCCCCAAAATGGTGATGG - Intronic
919124826 1:193381219-193381241 CAGAACCCCTTGAATGAAGGGGG - Intergenic
921928155 1:220730467-220730489 CACAATCCCTAAATTGATGAGGG + Intergenic
923873493 1:238021357-238021379 TAGAAGCCCTGGTATGGTGAGGG + Intergenic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
924807269 1:247371516-247371538 CAGAAGCCCTAGAATGCGGGGGG + Intergenic
924819443 1:247474410-247474432 CTGAATTCCCAGAATGATGAAGG - Intergenic
1064944149 10:20769650-20769672 CAGAAGCCAAAGGATAATGATGG + Intergenic
1065012579 10:21432805-21432827 CAGAGGCCCTAGAAGGCAGAGGG + Intergenic
1065699093 10:28407414-28407436 CAGAAGTCCAAGAAAAATGATGG - Intergenic
1067700174 10:48565909-48565931 CAGTAGTCCTAGCATGGTGAAGG + Intronic
1068505447 10:57894333-57894355 CCTAAGCCCAAGAATGATTAAGG - Intergenic
1069465639 10:68636392-68636414 AAGAAGCCCTGGACAGATGAGGG + Intronic
1071783184 10:88870038-88870060 CAGAAGCTCTTGGATGATGGGGG - Intergenic
1075491781 10:122877706-122877728 CAAAAGCCCAAGAATAATCAAGG + Intronic
1077357977 11:2127402-2127424 CAGAAGCCCTGGAATGAGGCTGG + Intergenic
1078982805 11:16557014-16557036 CAGAAGCCCAAGACTTCTGATGG + Intronic
1079345918 11:19652262-19652284 GAGCAGCCCTGGAATGAGGATGG - Intronic
1079890457 11:26046023-26046045 CTGAAGCTGTAGAATGATCATGG + Intergenic
1080345834 11:31323387-31323409 CAGAAGCCATAGAATTTTTATGG + Intronic
1080886783 11:36375325-36375347 CAGAAGCCCTAGAATGATGAAGG - Intronic
1081015542 11:37874567-37874589 CAGTAGCCCTAGTATAATCATGG - Intergenic
1082567518 11:54698992-54699014 CAGAAACCCTACAATGCGGAAGG - Intergenic
1082633811 11:55572349-55572371 CATAACCCCTAGAATGATTGTGG + Exonic
1085084168 11:73655768-73655790 CAGAAACCCAAGAAGGAGGAGGG - Intronic
1085102104 11:73809599-73809621 GAAAAGCCCTAGCCTGATGATGG - Intronic
1086080782 11:82900678-82900700 AAGAGGCCCTAGCATGATAAGGG - Intronic
1089316561 11:117595145-117595167 CAGAAGCACTTTAATGAGGAAGG + Intronic
1093643196 12:21552042-21552064 CAGAAGCCCAGGGATGAGGAAGG + Intronic
1096025962 12:48361270-48361292 CAGAAGCCTTACAATGATGGTGG - Intergenic
1097988562 12:65810045-65810067 CTTAAGCCCTAGAGTGATAATGG + Intergenic
1098500758 12:71188859-71188881 CAGAAACCCTACAATCAAGAGGG + Intronic
1098772845 12:74576465-74576487 CACAAGCCCTAGAATCTTGATGG - Intergenic
1099478168 12:83133549-83133571 CAGAAGACCTAGAAACATGCAGG - Exonic
1100734280 12:97509724-97509746 CAGGAGCCCTGGATTGATGGAGG + Intergenic
1101387950 12:104274297-104274319 CAGAAGCCCGAGACAGTTGATGG - Intronic
1103602507 12:122063276-122063298 CAGAAGCCTTAGAGAGAGGAGGG - Intergenic
1104265390 12:127227606-127227628 AAGAAACCCCTGAATGATGACGG + Intergenic
1105447044 13:20466544-20466566 CACAAGCCCTTGAATAATCAGGG + Intronic
1105795723 13:23850600-23850622 CCTAATCCCTAGGATGATGATGG - Intronic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1108486716 13:50934434-50934456 CATCATCCCTAGAGTGATGATGG + Intronic
1109681922 13:65763185-65763207 CAGAAGACTTACAATCATGATGG + Intergenic
1110121867 13:71892306-71892328 CAGAAGCCCAAAAATGGTGGTGG - Intergenic
1112044449 13:95582144-95582166 CAGAAGCACTAGAATCATGGAGG + Exonic
1112163758 13:96895961-96895983 CAAAAGCCCAAGAATAATTAAGG + Intergenic
1112250141 13:97771741-97771763 CAGAATCCCTTGAATGAAGGGGG - Intergenic
1112477102 13:99741429-99741451 CACAAGCCCTCGATGGATGAAGG - Intronic
1112921502 13:104618391-104618413 CAGAAGCTCTAGCTTGATGTGGG - Intergenic
1113223236 13:108129378-108129400 CAGAAACTCTGGATTGATGATGG - Intergenic
1114233330 14:20802985-20803007 CAGCAGCCCTAGAAAGACGGCGG - Exonic
1114520101 14:23328376-23328398 CAGGACCCCTGCAATGATGATGG - Intergenic
1115967242 14:38904694-38904716 CAGAAGTCCTAAAATCATGTTGG + Intergenic
1117944351 14:61001890-61001912 CAGAAGCGCTAGTATAATAAAGG - Intronic
1119640889 14:76314153-76314175 CAGAAGCCTGAAAATGCTGATGG - Intronic
1119889500 14:78172331-78172353 CAGAAGCCCTTGAACGATGAAGG - Intergenic
1120209983 14:81624437-81624459 CCCCAGCCCTAGAATGGTGAGGG + Intergenic
1124416431 15:29476380-29476402 CAGAAGCCTAAAAATAATGAAGG - Intronic
1125225825 15:37395241-37395263 CAGACACACTAAAATGATGACGG + Intergenic
1125761724 15:42100697-42100719 CAGTAGCCCTAGAATGAATGAGG - Intergenic
1125983941 15:44030983-44031005 AAGAAGCCCTAAAGTGATGCAGG + Intronic
1129712553 15:77827889-77827911 CAGAGGCCCTGGAATGAGGCAGG + Intergenic
1130060773 15:80568471-80568493 CAGAATGCCCAGAATCATGACGG + Intronic
1133025436 16:2987196-2987218 CAGAAGGGCTATAATGAGGAAGG - Intergenic
1138339582 16:56279865-56279887 CAGAAGACCTTAAATGATGAAGG - Intronic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1143999689 17:11041424-11041446 CCTAAGCCCAAGAATGATTAAGG - Intergenic
1145764927 17:27452029-27452051 GAGAAGCCATAGCAAGATGAGGG - Intergenic
1146771915 17:35576857-35576879 AAGTATACCTAGAATGATGAAGG + Intronic
1147585096 17:41649538-41649560 CAGAACCCCCAGAATGCAGAGGG + Intergenic
1149052163 17:52318637-52318659 ATGAAGCCCCAGAATGATGTGGG + Intergenic
1151060469 17:71086622-71086644 CTGATGCCCTAAAATGATTAAGG - Intergenic
1151855317 17:76717157-76717179 CTGAAGCCCTTGACTGCTGAAGG - Intronic
1158614701 18:58975934-58975956 CTAAAGTCTTAGAATGATGACGG + Intronic
1159287579 18:66373967-66373989 CAGAACCCCTTGAATGAAGTGGG + Intergenic
1159430993 18:68353310-68353332 CCAAAGCCCAAGAATAATGAGGG - Intergenic
1162943634 19:14029202-14029224 CAGAAGACCTAGCTTCATGAGGG + Intronic
1164086995 19:21912031-21912053 CAGAACCCCAAGGATGAAGAGGG - Intergenic
1164172654 19:22738959-22738981 CAGAACCCCAAGGATGAAGAGGG + Intergenic
1167081582 19:47279782-47279804 TAGAAGCCCAAGACTGGTGAGGG + Intergenic
1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG + Intergenic
926882410 2:17561345-17561367 CAGAAGCCCTAGCATGTACAAGG + Intronic
927351732 2:22124592-22124614 CAGAACCCAAAGAATGATGGGGG + Intergenic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
929722742 2:44387865-44387887 CAGAAACCCTACAATGCGGAAGG - Intronic
932684041 2:73852652-73852674 CAGAAGCCATAGGAGGAGGAAGG + Intronic
932927949 2:75998790-75998812 CAGAAAGCCAAGAATGATGTAGG - Intergenic
935466436 2:103403778-103403800 GAGAAACCCTTGAATAATGAAGG + Intergenic
937845839 2:126577890-126577912 CAGAAGACCAAGAATAATAAAGG + Intergenic
938342775 2:130546543-130546565 CAGAAACCCCAGAGTGATGGTGG - Intronic
938347058 2:130574179-130574201 CAGAAACCCCAGAGTGATGGTGG + Intronic
940293664 2:152100626-152100648 CAGAAGCACAAGAATTATGTGGG - Intergenic
941921708 2:170857408-170857430 AACAAACCCAAGAATGATGAAGG - Intronic
941934301 2:170971237-170971259 CAGAAGCACTTGAATTATGGTGG + Intergenic
943363405 2:186947150-186947172 TAGAAGCTAGAGAATGATGAAGG - Intergenic
943459999 2:188160821-188160843 CAGAAGCCTTAGAATTAGAAAGG + Intergenic
944460481 2:199944363-199944385 CAGAAGCCTTAAAATGATAGAGG - Intronic
945308222 2:208280649-208280671 CAGAACTCCTTGAATGAAGAGGG - Intronic
946449206 2:219765161-219765183 CACAATCCCAAGAATTATGATGG - Intergenic
946694649 2:222342471-222342493 CGGAAGCCCCACAATCATGATGG + Intergenic
947050266 2:226034488-226034510 CAGAAACCTTAAGATGATGAAGG - Intergenic
1170089680 20:12576834-12576856 CAAAAGCCCCACAATGATGGGGG + Intergenic
1171335353 20:24380634-24380656 CAGAAAACAAAGAATGATGAAGG - Intergenic
1171771089 20:29324129-29324151 CGGAAGCCCGAGAACGAGGACGG + Intergenic
1172216789 20:33241393-33241415 CAGAAGACCTTGAATGGGGAGGG - Exonic
1176013080 20:62910942-62910964 CAGGAGCCCGAGAACGATCAGGG - Exonic
1178746068 21:35251442-35251464 CTTAAGCCATAGAATGAGGATGG - Intronic
1178801839 21:35802709-35802731 CAGAAGCCCTACAATCTAGAAGG + Intronic
1178808225 21:35857300-35857322 GAGCAGCCCAAGAATGATGCAGG + Intronic
1182889275 22:33803203-33803225 CAGAACCCCTAGAACATTGAGGG - Intronic
1182963207 22:34496218-34496240 CAGAAGCCCTAGAATAGAGGAGG - Intergenic
1184418493 22:44365599-44365621 CAGAATCCCAAGAAAGATGTGGG + Exonic
951913647 3:27776990-27777012 CAGAAGCCATAGAGTGGGGAGGG + Intergenic
952046584 3:29328825-29328847 CAAAAGCCCTATAAAGCTGAGGG + Intronic
952443709 3:33359734-33359756 CAGAAGCCCAAGAGTGAGGCTGG + Intronic
953356080 3:42257320-42257342 GAGAAGTGCTAGAGTGATGAAGG + Intergenic
953512765 3:43559618-43559640 CAGAAGGCCTCCAAAGATGAGGG + Intronic
955535572 3:59919820-59919842 CAGAAGCGATGGAGTGATGAGGG - Intronic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
957962341 3:87272834-87272856 CAGAAGAAATATAATGATGAGGG + Intronic
957963289 3:87288738-87288760 CGGAGGCCTCAGAATGATGAGGG - Intergenic
964034063 3:152174387-152174409 CAGACCACCTAGAATAATGAGGG + Intergenic
967475761 3:189915519-189915541 CAGTTTTCCTAGAATGATGAGGG - Intergenic
967841743 3:194010449-194010471 CAGTGGCCCTGGAATGATGCTGG - Intergenic
969879470 4:10161208-10161230 CAAAAGACCTAGAATGAAGAGGG + Intergenic
970470904 4:16378592-16378614 CAGAACCCCAAGGATGAAGAGGG - Intergenic
970473489 4:16399866-16399888 TGGAATCTCTAGAATGATGAGGG + Intergenic
971259928 4:25046819-25046841 TACAAGCCAAAGAATGATGAAGG - Intergenic
971428040 4:26535152-26535174 AGGAAGCCCAGGAATGATGACGG - Intergenic
971600061 4:28581247-28581269 CAGAAGCCTCAGAATCATGGTGG - Intergenic
971958202 4:33451002-33451024 CAGAAGCATTAGCATGGTGAAGG - Intergenic
973102734 4:46293270-46293292 CAGAACCCCTTGAATGAAGGGGG + Intronic
974623329 4:64388965-64388987 AAGAACCCCTGGAATTATGATGG - Intronic
977148645 4:93480310-93480332 CAGAAGCCCAATACTGAAGAAGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
991352646 5:65734461-65734483 CTGAAGTTCTAGAATGATGCAGG + Intronic
991675976 5:69090343-69090365 CCCAAGCCCAAGAATGATTAAGG + Intergenic
995957950 5:117802460-117802482 CAGAAAACCTATAATCATGATGG - Intergenic
996171578 5:120299175-120299197 CAGAAACCATAGATTTATGATGG - Intergenic
996713989 5:126571701-126571723 AATAAGACCTAGAACGATGAAGG + Intronic
1003326298 6:5093913-5093935 CAGCATCCCTAGAAAGCTGAGGG - Intergenic
1011768378 6:90649096-90649118 TGGTAGCCCTAGAATGATGCAGG - Intergenic
1013153183 6:107466402-107466424 CAGATGTCCCAGATTGATGAAGG + Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1014956238 6:127620232-127620254 CATAAGCCAAAGAATGATCATGG + Intergenic
1020466814 7:8489284-8489306 CAGACTCCCTAGAATGAAGAAGG - Intronic
1023153273 7:37222391-37222413 GATAAGCCCTTGACTGATGAGGG - Intronic
1024086408 7:45895068-45895090 CAGAACCCCTTGAATGAAGGAGG - Intergenic
1024981850 7:55163874-55163896 CAGAAGCCGAACAGTGATGATGG + Intronic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025860835 7:65326075-65326097 CAAAAGCCCAAGACTGAGGAGGG - Intergenic
1028383801 7:90229590-90229612 CAGAGTCCCTGTAATGATGATGG + Intronic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1030122050 7:106119766-106119788 CAAAAGCCCTGGAATGATTAAGG - Intergenic
1032021090 7:128407422-128407444 CATGAGCCCAAGAATGCTGAAGG - Intronic
1035672442 8:1429910-1429932 CAGAAGGCCGTGTATGATGAAGG - Intergenic
1036415530 8:8544347-8544369 CAGAAGTCAGAGAATAATGAGGG - Intergenic
1039374632 8:37020853-37020875 CAGCAGCCCCAGTATGATAATGG - Intergenic
1040948833 8:52915308-52915330 CAGTTGGCCAAGAATGATGATGG + Intergenic
1043606013 8:82000779-82000801 CAGAATTATTAGAATGATGAAGG - Intergenic
1045338744 8:101233112-101233134 CATAAGTCCAAGAAAGATGAAGG + Intergenic
1047313122 8:123708834-123708856 CAGAAACCCAAGAATGCTAAGGG - Intronic
1048509669 8:135050846-135050868 CAAAAGCCCTGGAATGCAGAAGG + Intergenic
1050010401 9:1180117-1180139 AAGAACCCCTGGAAAGATGAAGG - Intergenic
1050641556 9:7673332-7673354 AAGAAGCCATAAAAAGATGATGG + Intergenic
1052084291 9:24245506-24245528 CAGAAGCCCTAGAATGCAAGAGG + Intergenic
1056951316 9:91042877-91042899 CAGAAGCCCGAGCCTGCTGAGGG - Intergenic
1058734315 9:107880062-107880084 AAGAAGGGCTAGAATAATGAGGG + Intergenic
1187202058 X:17144650-17144672 CAGAACCTCTTGAATGATGAAGG + Intronic
1187869247 X:23750798-23750820 CAAAAGCCCCAGGATAATGATGG + Intronic
1194445695 X:93984992-93985014 CACAAGTCTCAGAATGATGAAGG - Intergenic
1194570620 X:95550399-95550421 CAGAACCCCTTAAATGAAGAAGG - Intergenic
1196059925 X:111397001-111397023 CATAAGCCCTAGAAAGATCAAGG + Intronic
1196517883 X:116634552-116634574 CAGAAGACCTAGAATAGTCAAGG + Intergenic
1196543752 X:116938660-116938682 CAGAAAACCTACAATCATGATGG + Intergenic
1197431735 X:126375845-126375867 GAGAAGCCTCAGAATCATGAAGG + Intergenic
1199435592 X:147809088-147809110 CAGAAGCTCCAGACTGATTAGGG - Intergenic
1199996102 X:153027878-153027900 CAGAAGCCTCAGATAGATGAGGG - Intergenic