ID: 1080888485

View in Genome Browser
Species Human (GRCh38)
Location 11:36388175-36388197
Sequence ATGGGCTAGCAAATAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080888485_1080888487 -7 Left 1080888485 11:36388175-36388197 CCAGTGTTTATTTGCTAGCCCAT 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1080888487 11:36388191-36388213 AGCCCATATGTTCCTGCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1080888485_1080888486 -8 Left 1080888485 11:36388175-36388197 CCAGTGTTTATTTGCTAGCCCAT 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1080888486 11:36388190-36388212 TAGCCCATATGTTCCTGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080888485 Original CRISPR ATGGGCTAGCAAATAAACAC TGG (reversed) Intronic
901471808 1:9461919-9461941 CAGCCCTAGCAAATAAACACAGG + Intergenic
902962801 1:19976780-19976802 ATGGGAAGGCAAATAAAGACAGG - Intronic
904260836 1:29286801-29286823 ATGGGGTAGCAAATACATAATGG - Intronic
906704003 1:47881346-47881368 ATGGGCTTACACATAAACATGGG - Intronic
907367004 1:53970101-53970123 ATGTGCTATAAAATACACACTGG + Intergenic
909152970 1:72032054-72032076 AAGAGCTAGAAAATAAACTCAGG + Intronic
909260401 1:73481557-73481579 ATATGCTACCAAATCAACACTGG + Intergenic
910987666 1:93021840-93021862 ATGGGCTAGCAAACGGAAACAGG - Intergenic
911441922 1:97937835-97937857 CTGGGATTGCAAATAAACACTGG - Intergenic
920631401 1:207656447-207656469 ATGGCCTTGCAAATAAATATAGG + Intronic
920641888 1:207760567-207760589 ATGGCCTTCCAAATAAATACAGG + Intronic
1063360912 10:5457368-5457390 AAGGCTTAGCAAAGAAACACTGG - Exonic
1069224088 10:65920027-65920049 ATTCGTTACCAAATAAACACAGG - Exonic
1080415624 11:32067498-32067520 ATGGGCTTGTGAAGAAACACAGG - Intronic
1080888485 11:36388175-36388197 ATGGGCTAGCAAATAAACACTGG - Intronic
1081711053 11:45215654-45215676 TTGGGCTAGCACATTAAAACAGG + Intronic
1085991011 11:81844450-81844472 ATGTGCTAACAAATAACCAAGGG - Intergenic
1087489717 11:98809573-98809595 ATGGGCTTCCAAATACACACTGG - Intergenic
1088166823 11:106949288-106949310 ATGGGCTAGTAAGTAAAAGCTGG - Intronic
1091104310 11:132904070-132904092 ATGGGCTGGCAAACAAAGATTGG + Intronic
1094393569 12:29979765-29979787 ATGTGCTAGCAAATTAAAAATGG + Intergenic
1096171114 12:49470809-49470831 ATGGGTAAGCAACAAAACACTGG - Intronic
1101088467 12:101259996-101260018 ATAGGCAAGCAAATAATCAGTGG - Intergenic
1107789907 13:43991334-43991356 AGGGTCTAGCAGATAAATACTGG + Intergenic
1108781339 13:53839156-53839178 ATGGGCTAATTCATAAACACAGG + Intergenic
1109072910 13:57791622-57791644 AGGGGCTAGCAATAAAAAACTGG - Intergenic
1111869037 13:93807121-93807143 ATTGTATAGCAATTAAACACTGG + Intronic
1114731506 14:24997517-24997539 ATGGCTTAGTCAATAAACACAGG - Intronic
1115028773 14:28769968-28769990 ATGGATTTGGAAATAAACACAGG - Exonic
1116958228 14:50944839-50944861 ATGGCATAACAAATAAACATCGG - Intergenic
1120013631 14:79445540-79445562 ATGGGATAGAAAATTACCACTGG + Intronic
1120495905 14:85234915-85234937 ATGAGCTGGTAACTAAACACAGG + Intergenic
1123581129 15:21715711-21715733 ATGGCCTACCAAATAAACAATGG + Intergenic
1123617778 15:22158334-22158356 ATGGCCTACCAAATAAACAATGG + Intergenic
1124036608 15:26058772-26058794 TTGGAATAGCAAATGAACACTGG - Intergenic
1126721924 15:51590799-51590821 ATGTGGTAGAAAATACACACAGG + Intronic
1126906168 15:53368356-53368378 AAGGGCAAGCCATTAAACACGGG + Intergenic
1135614791 16:23901838-23901860 CTGGGTTTGCAAATACACACTGG + Intronic
1137980239 16:53063278-53063300 ATGAGCTGGAAAATAAACCCAGG + Intronic
1139287064 16:65825260-65825282 ATGGGCTAGCAAGTAAAATGGGG - Intergenic
1139481925 16:67235607-67235629 AGGGGCCAGAAAAGAAACACTGG - Intronic
1142226371 16:88879685-88879707 AAGTGCATGCAAATAAACACAGG + Intronic
1142241022 16:88945543-88945565 ATGATCTGGCAAATAAGCACAGG + Intronic
1144273946 17:13646825-13646847 GTGGGGAATCAAATAAACACAGG - Intergenic
1146099477 17:29966023-29966045 AAAGCCTACCAAATAAACACAGG - Intronic
1154223986 18:12484313-12484335 TTGGTCTGGAAAATAAACACAGG - Intronic
1154467912 18:14667827-14667849 ATGGGCTACCACATCAACACAGG - Intergenic
1159236619 18:65682843-65682865 ATGGGATAACAAACAAACAATGG + Intergenic
1159578119 18:70204728-70204750 ATGGGCAAGCAACTTAACATTGG + Intronic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
928816737 2:35305419-35305441 ATGGGCAAGCAATCAAACTCGGG + Intergenic
931912485 2:66916333-66916355 ATAGACTAGAAAATAAACAGTGG - Intergenic
932612539 2:73210479-73210501 ATGAGCTAGTGAAGAAACACTGG - Intronic
932942620 2:76185872-76185894 ATAGGCTAGCATACAACCACAGG - Intergenic
940170210 2:150821219-150821241 ATGGACTAGAAAAAAAAAACAGG + Intergenic
940769015 2:157820506-157820528 ATAAGCCAGAAAATAAACACTGG + Intronic
941924916 2:170885120-170885142 ATGGCCGAACACATAAACACTGG + Intergenic
943822612 2:192345869-192345891 ATAAGCTAGCTAATAAAAACTGG + Intergenic
945825397 2:214715387-214715409 ATGGGATAGAGAAAAAACACAGG + Intergenic
947101648 2:226627563-226627585 ATCGGCTAAGACATAAACACTGG - Intergenic
947168254 2:227284447-227284469 ATGGGCAGGTAACTAAACACTGG - Intronic
947393614 2:229665424-229665446 ATGGGCAAGCAACCAAAAACAGG + Intronic
1170242162 20:14179000-14179022 ATAGGCTAGCAAAAAACCAAAGG + Intronic
1172936662 20:38625312-38625334 TTGAGCAACCAAATAAACACAGG + Intronic
1175207037 20:57319010-57319032 AGGGGCTGACAAATAAACATGGG - Intergenic
1176269206 20:64226895-64226917 ATGGGCTGGTAAATGAACAGAGG - Intronic
1176806600 21:13489826-13489848 ATGGGCTACCACATCAACACAGG + Intergenic
1178230280 21:30775855-30775877 AGGGACCAGAAAATAAACACAGG + Intergenic
1183031410 22:35109046-35109068 ATCGGTTAGGAAATAAACACAGG - Intergenic
953503529 3:43460986-43461008 AGGGGCTAGAAAAAAAAAACAGG + Intronic
958023859 3:88027753-88027775 ATAGGCCAGCAAACAAAGACCGG - Intergenic
960053104 3:113256107-113256129 ATGGGCGAACAAATAAAGCCTGG - Intronic
966458854 3:180151742-180151764 ATGGTCTAGTAATTGAACACTGG - Intergenic
970136259 4:12927862-12927884 ATGGGATCTTAAATAAACACAGG - Intergenic
970842107 4:20485882-20485904 ATTGGTTAAGAAATAAACACGGG - Intronic
976928169 4:90528344-90528366 ATGGGGCAGCAAAGAAAAACTGG - Intronic
976955423 4:90892276-90892298 AGGGGCTAGAAAATAAAAGCAGG - Intronic
984606887 4:181796046-181796068 ATGGGCTACAGAATAAACAGTGG + Intergenic
991240147 5:64449210-64449232 ATTGGTTACCAAATACACACTGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
995877717 5:116808214-116808236 GTGGGCTAGCAAACAAATAAAGG + Intergenic
995888928 5:116927858-116927880 AACAGATAGCAAATAAACACAGG - Intergenic
996086774 5:119312959-119312981 ATAGGCTATCTAATAAAAACCGG + Intronic
996832934 5:127759565-127759587 ACTGGCTAGCATATAAACAATGG - Intergenic
999957125 5:156714747-156714769 ATGATGTAGCAAATAAAAACAGG - Intronic
1000257409 5:159553107-159553129 ATGGCCTAGAATATCAACACAGG - Intergenic
1002985127 6:2182541-2182563 TTGGAATTGCAAATAAACACTGG - Intronic
1003274895 6:4641338-4641360 AGGGGCCAATAAATAAACACGGG + Intergenic
1003633148 6:7807000-7807022 ATGGGATAGCAGAGAAACAGTGG - Intronic
1008602863 6:53112666-53112688 ATGTGGTAGAAAGTAAACACAGG - Intergenic
1013943200 6:115690986-115691008 AAGAGATAGCAACTAAACACTGG + Intergenic
1018891474 6:167986134-167986156 AAGGGCTACCACAGAAACACTGG - Intergenic
1021045625 7:15919401-15919423 ATGAGCTATCAAACAAACAAGGG - Intergenic
1021794420 7:24239395-24239417 ATATGCTTGCAAATAATCACAGG - Intergenic
1021993180 7:26155737-26155759 ATGGGCTGGAAAAACAACACTGG + Intronic
1030927096 7:115471971-115471993 ATGGGCAAGCAAAACAACATGGG - Intergenic
1031300156 7:120054884-120054906 ATGGGCTACTAAATAAAGGCAGG - Intergenic
1038002119 8:23400869-23400891 ATGAGCTAGGAAACAAACCCTGG + Intronic
1043312256 8:78875526-78875548 ATGGGCTAAAAGATACACACTGG - Intergenic
1044514539 8:93122965-93122987 ATGGACTAATACATAAACACAGG + Intergenic
1045855637 8:106762539-106762561 ATGGGGCAGCAAACTAACACAGG + Intronic
1047104463 8:121718256-121718278 ATGGAATAACAAAGAAACACAGG - Intergenic
1048695446 8:137022964-137022986 ATGTGCAAGCATATAAACAGAGG + Intergenic
1049144763 8:140991261-140991283 ATTGGCTAGCATATAATAACAGG - Intronic
1050263705 9:3868116-3868138 AGAGGGTAACAAATAAACACAGG - Intronic
1051056770 9:12996669-12996691 AAAGGCTAGCAAAAAAATACGGG + Intergenic
1051507530 9:17842885-17842907 ATGGAGTAGTAAATAAAGACAGG - Intergenic
1051902053 9:22053911-22053933 ATGGTTTAGCAAAAAAGCACAGG + Intergenic
1052376574 9:27724290-27724312 TTGGGGTAGGAAATAAACCCTGG - Intergenic
1055350374 9:75380437-75380459 ATGGGCTAGCAAATAAGATTAGG + Intergenic
1055409662 9:76015592-76015614 ATGGGTGAGCAGAAAAACACTGG + Intronic
1058131230 9:101256030-101256052 ATGGGTTAGCAATGGAACACTGG - Intronic
1060167651 9:121432240-121432262 GTGTCCTAGCAAATAACCACAGG - Intergenic
1062570327 9:137181986-137182008 ATGGGCTATGTACTAAACACAGG + Intronic
1188734724 X:33698335-33698357 ATGGGCTAGCTCATACAAACAGG - Intergenic
1197249355 X:124198844-124198866 TTGGGCTTGCAAATATAAACTGG + Intronic
1199653803 X:149974723-149974745 ATTGGCAATAAAATAAACACAGG - Intergenic