ID: 1080891930

View in Genome Browser
Species Human (GRCh38)
Location 11:36416686-36416708
Sequence TACCTAGACTTTTCTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080891930 Original CRISPR TACCTAGACTTTTCTCTTCC TGG Intronic
900033518 1:388372-388394 TAGCTAGATATTTTTCTTCCAGG + Intergenic
900054354 1:618261-618283 TAGCTAGATATTTTTCTTCCAGG + Intergenic
900961460 1:5923813-5923835 TACTGAGAATTTTCTCTTACTGG - Intronic
902163328 1:14550136-14550158 TACTTAGACTTCTCTGTGCCAGG + Intergenic
902434845 1:16391853-16391875 TTCCTAGAATGTTTTCTTCCAGG - Intronic
902885229 1:19400105-19400127 TCCCTTCTCTTTTCTCTTCCAGG + Intronic
902944175 1:19822293-19822315 TCCCAAAACTCTTCTCTTCCAGG - Intergenic
903424602 1:23244586-23244608 TGTCTAGAGTTGTCTCTTCCAGG + Intergenic
904846727 1:33424837-33424859 GTCCTTGACTTTTATCTTCCAGG - Intronic
906502216 1:46349603-46349625 GACCTAGACCCTTCTTTTCCAGG + Intronic
907666962 1:56441606-56441628 TTCCAAGTCTTTTCTCCTCCAGG - Intergenic
908334493 1:63106894-63106916 GACCAAGACACTTCTCTTCCAGG - Intergenic
910401729 1:86844005-86844027 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
911023629 1:93413549-93413571 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
911107696 1:94149425-94149447 TAACTAGATCTTTTTCTTCCAGG - Intronic
911170602 1:94767345-94767367 TACCTAGAGTTGTCACTTCTGGG + Intergenic
911600393 1:99842054-99842076 TACCTAAAATGTTCTCTGCCTGG - Intergenic
914331330 1:146673322-146673344 TAACCAGACTATACTCTTCCTGG - Intergenic
915096877 1:153469329-153469351 TAGCTAGACCTTTTTCTTCCAGG + Intergenic
916708848 1:167382414-167382436 TACTTTGGCTTTTCTTTTCCTGG - Intronic
917226678 1:172790933-172790955 AGCCTAGACTTTCTTCTTCCTGG - Intergenic
917373676 1:174324694-174324716 TAGCTAGGGCTTTCTCTTCCTGG - Intronic
919432803 1:197517877-197517899 TACCAAAACTTCTTTCTTCCTGG + Intronic
919665651 1:200288905-200288927 TAACTAGATTTTTTTTTTCCTGG - Intergenic
920576157 1:207062227-207062249 TTCCCAGACTTGTCTCCTCCTGG + Intronic
921990875 1:221365260-221365282 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
923279745 1:232431992-232432014 TACCATGACTTTTCTATTGCAGG + Intronic
923956671 1:239030395-239030417 TAGCTACATTTTTTTCTTCCAGG - Intergenic
924142189 1:241036985-241037007 TCCCTAGTCAGTTCTCTTCCAGG - Intronic
924337075 1:242995395-242995417 TAGCTAGATATTTTTCTTCCAGG + Intergenic
1063645282 10:7875374-7875396 TACTTAGCCATTTCTCTTTCTGG + Intronic
1064174420 10:13061911-13061933 TAGCTAGATCTTTTTCTTCCAGG - Intronic
1065160229 10:22911969-22911991 TACCTAGACGTTGCTCTGACAGG + Intergenic
1065414258 10:25467382-25467404 TAGCTAGATGTTTTTCTTCCAGG - Intronic
1065544192 10:26802158-26802180 TTCTTAGACTTTTAACTTCCAGG - Intronic
1065847227 10:29755679-29755701 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1066249091 10:33615666-33615688 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1067937106 10:50622540-50622562 TCCCTTGACATTTATCTTCCTGG - Intronic
1068366095 10:56052009-56052031 TAGCTAGACCTTTTCCTTCCAGG + Intergenic
1071674168 10:87639171-87639193 TAACTAGATCTTTTTCTTCCAGG - Intergenic
1072958487 10:99907880-99907902 TACCTACACCTGTATCTTCCCGG + Intronic
1073143163 10:101262193-101262215 TACCTAGACTGAGCTCTCCCTGG + Intergenic
1073867768 10:107824835-107824857 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1073935772 10:108630063-108630085 TACATGGACCTTTCTCTTGCTGG + Intergenic
1074313315 10:112341039-112341061 TACGCTGACTTGTCTCTTCCAGG + Intergenic
1074391778 10:113063995-113064017 TCCCTAGACTTGTCTATTTCAGG - Intronic
1074413756 10:113249484-113249506 TCCCCAGCCTTTTCTCTACCTGG - Intergenic
1075228524 10:120650984-120651006 TTCCTAGACTCTCGTCTTCCAGG - Intergenic
1075892752 10:125968165-125968187 TGCCTAGGCTGGTCTCTTCCTGG + Intronic
1076652579 10:131999971-131999993 TAGCTACATTTTTTTCTTCCAGG + Intergenic
1076652953 10:132002598-132002620 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1076979708 11:197955-197977 GACCTGGACCTTTCTCTGCCAGG + Intronic
1077911186 11:6572171-6572193 TACCCACACTTTCCCCTTCCCGG - Intronic
1078900203 11:15634979-15635001 TCCCTAGAGTTTTCTCTTAATGG + Intergenic
1079593892 11:22217183-22217205 TACTTAAACTAGTCTCTTCCTGG - Intronic
1080843886 11:36009183-36009205 TACTTCTACCTTTCTCTTCCTGG + Intronic
1080891930 11:36416686-36416708 TACCTAGACTTTTCTCTTCCTGG + Intronic
1081185318 11:40035410-40035432 TAGCTAGACCTTTTCCTTCCAGG + Intergenic
1083143300 11:60739235-60739257 TACCTATCCTTTTCTCTACTTGG + Intronic
1083387460 11:62322232-62322254 AATCTAGACCATTCTCTTCCAGG - Intergenic
1086521776 11:87676781-87676803 TACCTTTACTTGTTTCTTCCAGG + Intergenic
1087721846 11:101674442-101674464 TTCCAAGATTTTTCTCTTCTTGG - Intronic
1087805542 11:102551622-102551644 TACCTAGGCTTTCCCCTCCCAGG - Intergenic
1089864166 11:121617215-121617237 TAGCTAGATCTTTTTCTTCCAGG - Intronic
1090108029 11:123872909-123872931 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1095753687 12:45738743-45738765 CACCCAAACTTTTTTCTTCCTGG + Intronic
1097595987 12:61631338-61631360 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1097745074 12:63292546-63292568 TTTCTAGACCTTTCTCTTCCAGG - Intergenic
1098182578 12:67863601-67863623 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1099403333 12:82227530-82227552 TTCCTTGACTCTTGTCTTCCAGG + Intronic
1101671001 12:106872858-106872880 TACCTGGAGTTTACTCATCCAGG - Intronic
1104803600 12:131571037-131571059 TCTCTAGACTCTTCTCTCCCAGG + Intergenic
1104808120 12:131602447-131602469 TGCTTAGAATTTTCTTTTCCTGG + Intergenic
1106041116 13:26094816-26094838 TCCCTGTACTTTGCTCTTCCAGG - Intergenic
1106746382 13:32712817-32712839 TCACTAAACTTTGCTCTTCCTGG - Intronic
1107952957 13:45482058-45482080 TACCTAGATTTCTCACTTTCTGG - Intronic
1108279935 13:48851250-48851272 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1109185246 13:59260282-59260304 AATCAAGACTTTTCTCTTCAAGG - Intergenic
1109201591 13:59437236-59437258 TGCCTCTGCTTTTCTCTTCCTGG - Intergenic
1110696736 13:78499896-78499918 TAGGAAGACTTTTCTCTTCTTGG - Intergenic
1111254387 13:85646824-85646846 TACTGAGACTTTTCTCATCTGGG + Intergenic
1111730987 13:92076825-92076847 TAGCTAGATCTTTTTCTTCCAGG + Intronic
1111753567 13:92364079-92364101 TAGCTAGATTTTTCTCTTTTAGG - Intronic
1112280771 13:98061082-98061104 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1114205433 14:20567206-20567228 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1115144615 14:30211955-30211977 TCCTTAGACTTTTCCCTTACTGG - Intergenic
1117030513 14:51664351-51664373 CACCAAGAATTTTCTCTTCTGGG + Intronic
1117410723 14:55448519-55448541 GACCAAGACTTTTCACTTCGGGG + Intronic
1118478353 14:66140173-66140195 TTCCTAGCTTTGTCTCTTCCAGG - Intergenic
1118901216 14:69987463-69987485 TACAAAGAGCTTTCTCTTCCAGG - Intronic
1120107513 14:80513898-80513920 TAGCTAGATCTTTTTCTTCCAGG + Intronic
1120147847 14:80999358-80999380 TAACAAGTCTTTTCTCTTCTAGG + Intronic
1120425068 14:84337194-84337216 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1121025642 14:90614171-90614193 TACCTTGACTCTTATCATCCAGG - Intronic
1121731677 14:96191887-96191909 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1122616868 14:103024166-103024188 TGCGTAGACGGTTCTCTTCCTGG - Intronic
1122716402 14:103699179-103699201 GACCTGGACTGTGCTCTTCCAGG - Exonic
1122832675 14:104408294-104408316 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1123807252 15:23887694-23887716 TACCTAGACTTTTAGGTTCCAGG - Intergenic
1123961940 15:25412124-25412146 TACCTATGCTTTCCTCATCCCGG - Intronic
1124033235 15:26030335-26030357 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1126194578 15:45917895-45917917 TTCCTAGACTTGTCTCTGCCTGG + Intergenic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1127435363 15:58952208-58952230 TATGTTCACTTTTCTCTTCCTGG + Intronic
1127818149 15:62631038-62631060 TAGCTAGCCTTTTCTCACCCAGG + Intronic
1127860838 15:62993131-62993153 TACTGAGCCTTTTCTCTCCCAGG - Intergenic
1129618276 15:77118553-77118575 TACCCAGTATTTTCTCTACCAGG + Intronic
1131655805 15:94457508-94457530 TACCCAGATTATTCCCTTCCAGG - Intronic
1132100903 15:99022516-99022538 TAACTAGACTTTTCTTTTGGAGG - Intergenic
1133474261 16:6104929-6104951 TACCTAGAACTTTCTTTTCTAGG + Intronic
1133800126 16:9078533-9078555 TAGCTAGACGTTTTCCTTCCAGG - Intergenic
1134215440 16:12313443-12313465 TACCTGCCCTTCTCTCTTCCGGG + Intronic
1134397092 16:13875045-13875067 TAGCTAGATATTTTTCTTCCAGG + Intergenic
1135776260 16:25259264-25259286 TAGCTAGATGTTTTTCTTCCAGG - Intergenic
1136224411 16:28849025-28849047 TGCTAAGACTTCTCTCTTCCTGG + Intronic
1136586361 16:31188132-31188154 TGCCTAGAATTTTCTCCTCTGGG + Intronic
1136650496 16:31665686-31665708 TTCCCAGAGTCTTCTCTTCCTGG - Intergenic
1137477371 16:48821037-48821059 TTCCAAGTCCTTTCTCTTCCAGG + Intergenic
1138296704 16:55891989-55892011 TAGCTAGATTTTTTTCTTCCAGG + Intronic
1138676758 16:58656911-58656933 GCTCTTGACTTTTCTCTTCCCGG - Intergenic
1139466133 16:67155108-67155130 TGCCCAGACTTTTCTGTTCCAGG - Exonic
1139939375 16:70593828-70593850 TATCTAGATTTTTTTCTTGCAGG + Intronic
1140002226 16:71037579-71037601 TAACCAGACTATACTCTTCCTGG + Intronic
1141078671 16:81031914-81031936 TAACTTGATTTTTCTCTTCATGG + Intronic
1141601645 16:85130367-85130389 GAGCTAGGTTTTTCTCTTCCAGG + Intergenic
1143855227 17:9843314-9843336 TATCCAGACTCTGCTCTTCCCGG + Intronic
1144105746 17:11983604-11983626 TGCCTAGACTCTTCTTTTCATGG - Intronic
1145223574 17:21108811-21108833 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1146807515 17:35876826-35876848 TCCCTAGGCTTTTCTCTGCCAGG + Intronic
1149075326 17:52590492-52590514 GTCCTAGGCTTTTCTTTTCCTGG + Intergenic
1149421528 17:56515395-56515417 AACCTGGACTTTTTTCTTCAAGG + Intergenic
1153698912 18:7672833-7672855 TCACTAGACTTTTATGTTCCTGG - Intronic
1153920196 18:9782205-9782227 TCCCTAGACATTTCAGTTCCTGG + Intronic
1155298085 18:24403621-24403643 TACCTTGATATTTCTTTTCCAGG + Intergenic
1156656317 18:39292116-39292138 TACCTAGACTTTCCTGATCTTGG - Intergenic
1157792805 18:50547803-50547825 GACCTAGATTTTTCACTTCTAGG - Intergenic
1158624671 18:59060898-59060920 CACCTAGACTTTTCACCTCCAGG + Intergenic
1158864547 18:61625524-61625546 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1158871478 18:61692509-61692531 TAGCTAGACCTTTTCCTTCCAGG - Intergenic
1159594216 18:70367373-70367395 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1159653529 18:71004951-71004973 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1161716368 19:5878184-5878206 TCCCTGGAATTTTCTCTCCCCGG - Intronic
1164730376 19:30499765-30499787 CACCAAGACCTTTCTCCTCCTGG - Intronic
1164922373 19:32098236-32098258 TACATAGGATTTTCTCTTCTAGG + Intergenic
1165379821 19:35471080-35471102 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1165992315 19:39823661-39823683 TACCTAAACTTTTCTGTCCTAGG + Intergenic
925869180 2:8254354-8254376 TAGCTAGATCTTTATCTTCCAGG + Intergenic
926441221 2:12890609-12890631 TACGAAGACTTTTCACTTGCAGG + Intergenic
926906436 2:17810087-17810109 GAACCAGACTTTTCTCTTTCAGG - Intergenic
929866770 2:45724010-45724032 AACCTCCACTTTTCACTTCCTGG + Intronic
929937124 2:46301197-46301219 TAGTCAGACTTTTCTCTTTCTGG + Intronic
930444005 2:51447486-51447508 TACATACACTTTTTTCTTTCAGG + Intergenic
931418162 2:62100816-62100838 TAGCTAGATCTTTTTCTTCCAGG - Intronic
934155691 2:89197968-89197990 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
935889686 2:107662691-107662713 TAGCTAGATATTTTTCTTCCAGG - Intergenic
936615876 2:114047218-114047240 TTGCTACAGTTTTCTCTTCCTGG + Intergenic
937124517 2:119464931-119464953 GAGCAAGACTTTTCACTTCCCGG + Intronic
937551184 2:123094567-123094589 TAGCTAGATGTTTTTCTTCCAGG - Intergenic
937595086 2:123662590-123662612 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
937930194 2:127198904-127198926 TACACAGAGTTTTCTCCTCCTGG + Intronic
939061812 2:137431446-137431468 TAGCTAGATCTTTTTCTTCCAGG - Intronic
939973915 2:148694608-148694630 TACCCAAACTTTTCTCTTTAAGG + Intronic
940848973 2:158670573-158670595 CCCCTAGATTTTTCTCATCCTGG - Intronic
941443133 2:165563681-165563703 CTGCTAGACTTTTGTCTTCCAGG + Intronic
941443562 2:165570109-165570131 TCCAAAGACTTTTCTGTTCCTGG + Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
946531665 2:220577287-220577309 CACATAATCTTTTCTCTTCCAGG + Intergenic
947107579 2:226683647-226683669 TACTTAGTCTTTTCTACTCCAGG - Intergenic
1168823128 20:790432-790454 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1169280780 20:4265195-4265217 TGCCAAGACTTTTCTGTTGCAGG - Intergenic
1169324223 20:4662150-4662172 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1169330980 20:4716276-4716298 TACCTTGACTTCTAGCTTCCAGG - Intergenic
1175731087 20:61354336-61354358 TTCCAAGACTTACCTCTTCCTGG + Intronic
1176966853 21:15220680-15220702 TACTCAGACTTTTCTGTTTCTGG - Intergenic
1178796784 21:35752307-35752329 TTCCTAGACCTTTATCTTCGAGG - Intronic
1181777068 22:25167323-25167345 TACCTAGTAATTTCTCTTACGGG + Intronic
1181890927 22:26062839-26062861 TACATGGCCTTTTCTCTTCAGGG - Intergenic
1182463805 22:30501605-30501627 TTCCTTCATTTTTCTCTTCCAGG - Intronic
1183680273 22:39324463-39324485 TAGGTAGACTGATCTCTTCCAGG - Intergenic
1184848583 22:47104335-47104357 TAGCTAGATTTTTTTCTTCCAGG + Intronic
1184907492 22:47498735-47498757 GGCCTGGACTTTTCTCTTTCTGG - Intergenic
949491132 3:4590023-4590045 TGCCTAGAATTCTCTCTTGCAGG + Intronic
952107350 3:30085634-30085656 TAGCTAGATCTTTTTCTTCCTGG + Intergenic
952580744 3:34831044-34831066 TTCCTAGACTGTTCCTTTCCTGG - Intergenic
953427405 3:42806155-42806177 TAGCTAGATCTTTTTCTTCCAGG - Intronic
953943364 3:47122795-47122817 GACCCAGCCTTTTCTCTTTCAGG + Exonic
955212931 3:56958889-56958911 TACATTGTCTTTTCTCTTCTAGG - Exonic
956112946 3:65889378-65889400 TGCACAGACTTTTCTCTTCTGGG + Intronic
956708689 3:72021637-72021659 TAACTAGATCTTTTTCTTCCAGG + Intergenic
957297087 3:78346164-78346186 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
957465274 3:80581567-80581589 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
959296788 3:104545569-104545591 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
959869875 3:111314088-111314110 TACATAACCTTTTCACTTCCTGG - Intronic
960253653 3:115486870-115486892 TGCCTTGACTTTTCTCTCCAAGG + Intergenic
962094719 3:132281448-132281470 TAACTAGATCTTTTTCTTCCAGG + Intronic
963433184 3:145235526-145235548 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
963712892 3:148767847-148767869 TTTCTAGACTGTTCTTTTCCTGG - Intergenic
964845564 3:161040961-161040983 TACCTAGATCTGTTTCTTCCAGG + Intronic
965178141 3:165363147-165363169 TACCTTGACCTCTCTCTTCTGGG - Intergenic
965180402 3:165395361-165395383 TAGCTAGATCTTTTTCTTCCTGG + Intergenic
965545802 3:169915265-169915287 TTTCTTGACTTTTCCCTTCCTGG + Intronic
965911039 3:173776115-173776137 TAACTAAAGTTTTCTTTTCCTGG + Intronic
967070033 3:185954481-185954503 TACCTAGGCTAATCTCTACCAGG - Intergenic
970082207 4:12300210-12300232 TAGCTAGACCTTTTTCTTCTAGG - Intergenic
971713554 4:30148036-30148058 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
971751964 4:30662004-30662026 TAGCTAGATTTTTTTCTTCTAGG + Intergenic
972164568 4:36266669-36266691 TACCTCCCCTTTTCTCTCCCTGG + Intergenic
972207163 4:36788348-36788370 TACCTACACTTTCTTCTTCTTGG - Intergenic
975961697 4:79916656-79916678 TTATTCGACTTTTCTCTTCCTGG - Intronic
976317730 4:83677133-83677155 TTCCTGGACTTTTGTCTGCCTGG + Intergenic
976622771 4:87145815-87145837 GACCCAGACATTTCCCTTCCAGG - Intergenic
976970801 4:91099913-91099935 TAGCTAGTTTTTTTTCTTCCTGG - Intronic
977420335 4:96791660-96791682 AACCTACACTTTTCCCTTTCAGG - Intergenic
978780048 4:112542545-112542567 TACCAAGAGTTTTCTCTTAAGGG + Intronic
979240047 4:118439910-118439932 TAGCTAGATATTTTTCTTCCAGG - Intergenic
979361143 4:119766094-119766116 TACTCAGACTTTTAGCTTCCAGG + Intergenic
979812463 4:125054928-125054950 TACATAGGCCTTTATCTTCCAGG - Intergenic
980142528 4:128937425-128937447 TAAATAGACTTTTCTTTTACTGG - Intronic
981465462 4:145065974-145065996 CACCTAGATTTTTTTTTTCCTGG - Intronic
981900702 4:149858436-149858458 TAGCTAGTCTTTCCACTTCCAGG + Intergenic
982091219 4:151881561-151881583 CACCTAGAATGCTCTCTTCCAGG - Intergenic
982466358 4:155738047-155738069 TACCCTTACTCTTCTCTTCCAGG - Intergenic
983403278 4:167292717-167292739 TTTGTAGACTTTTCTCTGCCAGG - Intergenic
983638180 4:169919298-169919320 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
984257524 4:177406495-177406517 TATTTAGACATTTCTCTCCCAGG - Intergenic
985339624 4:188935401-188935423 TACCTACACTTTTCTTTTCTAGG + Intergenic
985482858 5:128167-128189 TAGCTAGATCTTTTTCTTCCGGG - Intergenic
986316206 5:6588874-6588896 TACTCAGGCTTTTCTCTTCTTGG + Intergenic
986488051 5:8260504-8260526 TACCTAGACATTCCTCTGCCAGG - Intergenic
986646885 5:9925515-9925537 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
988568070 5:32336473-32336495 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
993965478 5:94355273-94355295 TAGCTAGATCTTTTTCTTCCAGG - Intronic
993983842 5:94573685-94573707 TAGCTAGATCTTTTTCTTCCAGG - Intronic
995128872 5:108608913-108608935 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
995875902 5:116789245-116789267 GACCTAGACCTTCCTTTTCCAGG - Intergenic
996749691 5:126876053-126876075 TACCTAGACTAGGCTCTTTCAGG - Intronic
997799565 5:136846262-136846284 TTCCTAGACTTTGCTTTTCTTGG - Intergenic
998712052 5:144837275-144837297 TAATTAGCCTTTTATCTTCCTGG + Intergenic
999928030 5:156400615-156400637 TACATAAACTGTTCTTTTCCAGG - Intronic
1000200909 5:159010102-159010124 TAATTAGACTTTACTCTTTCGGG - Intronic
1002740302 5:181430496-181430518 TAGCTAGATATTTTTCTTCCAGG - Intergenic
1003475449 6:6477960-6477982 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1003687742 6:8321729-8321751 TATGTATACTTTCCTCTTCCAGG - Intergenic
1004196916 6:13513515-13513537 TGCCTAGACTTTTTCCTTTCTGG - Intergenic
1006552592 6:34837186-34837208 TAAATAGACTTTTCTCTTGCTGG + Intronic
1007526034 6:42494403-42494425 TACCTGTACTATTCTATTCCAGG - Intergenic
1009357183 6:62765116-62765138 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
1010293169 6:74163921-74163943 CACCTAGAGTTTTTTCCTCCTGG + Intergenic
1010888699 6:81276897-81276919 TACCAAGCCTTTTCTCATCTAGG - Intergenic
1011363160 6:86550017-86550039 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1011715448 6:90100293-90100315 TACCTAGCGATTTCACTTCCAGG - Intronic
1012319245 6:97822552-97822574 TGCCATGACTTTTCTCTTCTTGG + Intergenic
1012491504 6:99787637-99787659 CACCAATACTTTTCTCATCCTGG - Intergenic
1013108544 6:107046841-107046863 TTCCTAAACTCATCTCTTCCTGG + Intronic
1013163640 6:107570023-107570045 TACCCTTACTTCTCTCTTCCTGG - Intronic
1014828527 6:126074409-126074431 TATCTAGACTTTTCTCATCAAGG + Intergenic
1014841043 6:126220437-126220459 TACCTAGACATTTCCATTCTAGG + Intergenic
1015576184 6:134673544-134673566 TACTCAGACTGTTCTCTTCCTGG - Intergenic
1017485657 6:154900011-154900033 CAGGTAGACTTTCCTCTTCCAGG + Intronic
1018129858 6:160718639-160718661 TCCCTAGACTTTTTTCTTTTTGG + Intronic
1018154849 6:160976301-160976323 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1018189940 6:161301846-161301868 TAGCTAGATGTTTTTCTTCCAGG + Intergenic
1018260508 6:161965974-161965996 TAGCTAGATATTTTTCTTCCAGG - Intronic
1018671377 6:166180318-166180340 TACCTAGAAATTTCCCTTCTAGG - Intergenic
1018960389 6:168443238-168443260 TACCTTGATTCTGCTCTTCCAGG - Intronic
1019245412 6:170706097-170706119 TAGCTAGATATTTTTCTTCCAGG - Intergenic
1019295959 7:275378-275400 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1020473099 7:8561768-8561790 TACCTAAATTTTTCCCTGCCTGG - Intronic
1024322365 7:48084073-48084095 TAGCTAGAGCTTTTTCTTCCAGG + Intergenic
1024706159 7:51962571-51962593 TAACTAGACTCCTCTCTTACTGG + Intergenic
1026143118 7:67723019-67723041 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1026164335 7:67896666-67896688 TATCTAGAATTTTGTCTTCGTGG + Intergenic
1026308873 7:69166543-69166565 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1026661447 7:72306270-72306292 TAGCTAGATCTTTTTCTTCCAGG + Intronic
1027688015 7:81302118-81302140 TACCCAAACCTTTGTCTTCCTGG - Intergenic
1027979308 7:85197200-85197222 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1028575711 7:92347997-92348019 TACCTATATTTTTATCTTGCAGG - Intronic
1029332238 7:99868402-99868424 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1029686718 7:102153500-102153522 TACTTAGCCTTGACTCTTCCGGG - Intronic
1029931270 7:104373815-104373837 TAGCTAGATCTTTTTCTTCCAGG - Intronic
1033162797 7:139012259-139012281 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1033225910 7:139562305-139562327 CACCTAGATCTTTCTCTCCCAGG - Exonic
1033302474 7:140198720-140198742 GACCTTGCATTTTCTCTTCCAGG + Intergenic
1033416460 7:141166021-141166043 TAGCTAGGCTTGTCGCTTCCTGG - Intronic
1035502712 8:102106-102128 TAGCTAGATATTTTTCTTCCAGG + Intergenic
1038480753 8:27900258-27900280 TGCCTAGACTTTGCTGTACCAGG - Intronic
1038532325 8:28328497-28328519 TACCCCGAATTCTCTCTTCCAGG - Intronic
1038547012 8:28433547-28433569 TCCCGGGACTTTTCCCTTCCTGG + Intronic
1038673976 8:29606665-29606687 GACCCAGACTGTTCCCTTCCAGG - Intergenic
1038739087 8:30200812-30200834 TAGCTAGATTTTTTTCTTCCAGG + Intergenic
1039301195 8:36210452-36210474 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1039354306 8:36798474-36798496 TAGCTAGATCTTTTTCTTCCAGG + Intronic
1040601738 8:48891417-48891439 AACCTAGATATTTTTCTTCCTGG + Intergenic
1040714108 8:50226407-50226429 TAGCTAGTTTTTTTTCTTCCAGG + Intronic
1040949328 8:52920325-52920347 GACCATGACTTTTCTCTTACTGG + Intergenic
1041834827 8:62199717-62199739 TGCCATGAGTTTTCTCTTCCAGG + Intergenic
1043093722 8:75937762-75937784 CACCTGGACTTTGCTATTCCAGG + Intergenic
1043137542 8:76547404-76547426 ATCATATACTTTTCTCTTCCTGG + Intergenic
1043596690 8:81895989-81896011 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1043718486 8:83513178-83513200 TAGCTAGACCTTTTCCTTCCAGG - Intergenic
1044019151 8:87083279-87083301 TAGCTAGATCTTTTTCTTCCAGG + Intronic
1045013985 8:97982790-97982812 TAGCAAGACTTTTCTTTTTCTGG + Intronic
1045497671 8:102721989-102722011 TACCGAAACTTCTCTCTTCAAGG + Intergenic
1045666904 8:104497707-104497729 TATCCAGACTTTTATCCTCCTGG - Exonic
1045792065 8:105995495-105995517 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1046184653 8:110696961-110696983 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1046614741 8:116463679-116463701 TTCCTACACTTCTCCCTTCCTGG + Intergenic
1047114298 8:121823487-121823509 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1048655943 8:136536023-136536045 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1049933204 9:475781-475803 TAGCTAGATATTTTTCTTCCAGG + Intronic
1050636715 9:7620247-7620269 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1052140184 9:24971926-24971948 TACCTGGCGTTTTCTCTGCCTGG + Intergenic
1056390852 9:86140404-86140426 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1056998702 9:91487902-91487924 CACTTAGACTTTTCCATTCCAGG - Intergenic
1057444751 9:95105686-95105708 TCCCTGGACTTGACTCTTCCAGG + Intronic
1059872092 9:118588629-118588651 TAGCTAGACCTTTTCCTTCCAGG - Intergenic
1060534794 9:124376478-124376500 TCCTTAAACTTTTCTGTTCCTGG + Intronic
1060916297 9:127393061-127393083 TACAGTGACTTTTCTCTTCTAGG + Exonic
1061737084 9:132669190-132669212 TAGCTAGATCTTTTTCTTCCAGG - Intronic
1062258801 9:135646870-135646892 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1203605610 Un_KI270748v1:55304-55326 TAGCTAGATATTTTTCTTCCAGG - Intergenic
1185575288 X:1167561-1167583 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1185908918 X:3964631-3964653 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1187399891 X:18950339-18950361 CTCTTAGACTTTTCTCCTCCAGG - Intronic
1187920177 X:24194243-24194265 TACCTACCCTTTGTTCTTCCTGG + Intronic
1188105048 X:26139246-26139268 AACCTAGACTTTTCTCATCTTGG - Exonic
1188402562 X:29764847-29764869 TACCATGAATTTGCTCTTCCTGG + Intronic
1188523211 X:31061170-31061192 TACCTAATCTGATCTCTTCCTGG - Intergenic
1188876108 X:35431974-35431996 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1189155035 X:38748382-38748404 TACCTAGGCTTGTCCCTTCATGG - Intergenic
1190367447 X:49709600-49709622 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1190533587 X:51405661-51405683 TACCAAGAATTTTCTCTTCTGGG + Intergenic
1191642493 X:63442434-63442456 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1193027734 X:76862713-76862735 AACCTAGAGTTTATTCTTCCTGG + Intergenic
1193716358 X:84939217-84939239 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1193839157 X:86387560-86387582 AACCTAGGAATTTCTCTTCCAGG + Intronic
1194410593 X:93553069-93553091 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1197038377 X:121905040-121905062 TTCCTAGACTTGTCTCTTAAAGG + Intergenic
1197498140 X:127211088-127211110 TAGCTAGATCTTTTTCTTCCAGG + Intergenic
1199081920 X:143586737-143586759 TAGCTAGATCTTTTTCTTCCAGG - Intergenic
1199279226 X:145980592-145980614 TAGCTAGATCTTTTTCTTCCTGG + Intergenic
1199443762 X:147897626-147897648 TACCTTCCTTTTTCTCTTCCAGG + Intergenic
1201261019 Y:12158933-12158955 TAGCTAGATCTTTTTCTTCCAGG + Intergenic