ID: 1080896067

View in Genome Browser
Species Human (GRCh38)
Location 11:36449609-36449631
Sequence GGCTGCACACCCTGCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080896067_1080896071 2 Left 1080896067 11:36449609-36449631 CCAGCCAGGCAGGGTGTGCAGCC 0: 1
1: 0
2: 2
3: 43
4: 327
Right 1080896071 11:36449634-36449656 TACTCAGAGGACCCTGAGCTTGG 0: 1
1: 0
2: 0
3: 36
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080896067 Original CRISPR GGCTGCACACCCTGCCTGGC TGG (reversed) Intronic
900110770 1:1004631-1004653 GTCTCCCCACCCTGCCTGTCTGG + Intergenic
900129213 1:1080521-1080543 GCCTCCAGACCCTGCCTGGCTGG + Intergenic
900130505 1:1085269-1085291 GGCTGGACCATCTGCCTGGCAGG + Intronic
900592796 1:3467447-3467469 GGCTGCCCACCCTCCCTGGGAGG - Intronic
900619379 1:3580012-3580034 GGCAGCCCACCCAGCCTGCCAGG + Intronic
901377371 1:8849005-8849027 GGCTCTGCACGCTGCCTGGCTGG - Intergenic
902194901 1:14791237-14791259 GGCTGCAAACTCTGCCTCCCGGG - Intronic
902290026 1:15429393-15429415 GCCCCCACACCCTGCCTGGCTGG - Exonic
903035628 1:20490892-20490914 GGTTTCACACCGAGCCTGGCAGG - Intergenic
903362209 1:22783779-22783801 GGCCGCCCACCCTTCCTGCCTGG - Intronic
903648616 1:24909866-24909888 GCCTGGCCACCCTGCCTGACTGG - Intronic
903839033 1:26225324-26225346 GGCTACCCAGCCTGCCCGGCAGG - Intergenic
904133012 1:28289383-28289405 GGCACCACACCCAGCCCGGCAGG + Intergenic
904268284 1:29330722-29330744 GCCTGCACCCCCACCCTGGCTGG + Intergenic
904428941 1:30449539-30449561 GCCTGCACCCCCACCCTGGCTGG - Intergenic
905212100 1:36381416-36381438 GGCTGCTCCCCCTGCCTGGAGGG + Intronic
905489430 1:38332017-38332039 GGATGCAGAGTCTGCCTGGCCGG - Intergenic
906501608 1:46345137-46345159 GGCTCCAGATCCTACCTGGCAGG - Exonic
906533205 1:46535490-46535512 GGTTGCTATCCCTGCCTGGCAGG - Intergenic
906791400 1:48661331-48661353 TGCTGCTCCCTCTGCCTGGCAGG - Intronic
910251853 1:85205791-85205813 GGCTGCAAACTCTGCCTCCCAGG - Intergenic
910360883 1:86412787-86412809 GGCTGAATAGCCTGCTTGGCTGG + Intergenic
911266932 1:95753801-95753823 GGCTTCAGGCCCTCCCTGGCTGG - Intergenic
911657197 1:100458068-100458090 GGCTTAGCACCCTTCCTGGCAGG - Intronic
912755711 1:112323382-112323404 GCCTGCACACTCTGACTGCCAGG + Intergenic
914047186 1:144102581-144102603 GGCTGACCAGCCTGGCTGGCTGG + Intergenic
914938824 1:152004089-152004111 GTCTACACACCCTTCCTTGCAGG - Intergenic
915335228 1:155136981-155137003 TGCTGCACGCCCTGCCTTGCTGG + Intronic
915347935 1:155207528-155207550 GGATGCTCAGGCTGCCTGGCTGG - Intronic
915559431 1:156677694-156677716 GACTGCACTCCCTCCCAGGCTGG - Intergenic
916818394 1:168374910-168374932 GGCTGCACACAGTGCCCAGCTGG + Intergenic
919803147 1:201365470-201365492 GGATGGGCACCCAGCCTGGCTGG + Intronic
920452485 1:206070237-206070259 GGCAGCTCTCCCTGCCAGGCGGG - Intronic
920666078 1:207963788-207963810 GGCTGGTCTCCCTGGCTGGCCGG - Intergenic
921804136 1:219435032-219435054 TGCAGCACACTCTGCGTGGCAGG + Intergenic
922722150 1:227904642-227904664 GGCTGCCCACCCGGCCGGACAGG - Intergenic
923035194 1:230280677-230280699 GGCAGGACTCGCTGCCTGGCTGG - Exonic
924788212 1:247219860-247219882 GGCAGCACTCCCTGCCTAGGAGG - Intergenic
924808808 1:247383245-247383267 AGCTGAACAGCCTGCCAGGCTGG + Intergenic
1062841600 10:677771-677793 GGCTGGACACCTGGCCAGGCTGG - Intronic
1062854902 10:775182-775204 GGCAGCAAACCCTGCCCGTCGGG - Intergenic
1063110954 10:3037226-3037248 GGGTGTACACCAAGCCTGGCAGG + Intergenic
1063970795 10:11380032-11380054 GGCTGCACTCCTGGCCTGGCAGG + Intergenic
1064629502 10:17295423-17295445 GGCTGCAATCTCTGCCTCGCAGG + Intergenic
1065149785 10:22811068-22811090 GGCTTACCACCCAGCCTGGCAGG - Intergenic
1065628259 10:27653254-27653276 GCCTTCACAGCCTGCATGGCAGG - Intergenic
1067062934 10:43087254-43087276 TACTGGCCACCCTGCCTGGCTGG + Intronic
1069248974 10:66245029-66245051 TTCTTCCCACCCTGCCTGGCAGG + Intronic
1070041474 10:72784742-72784764 GGCTGTGCACCCTGCCTCTCTGG + Intronic
1070257584 10:74825398-74825420 GGCTGCGCCCCCGGCCAGGCCGG + Intergenic
1071982310 10:91015493-91015515 GGCTGCATACCCACCATGGCTGG - Intergenic
1072929259 10:99646551-99646573 GGCTGCACCCACTGTCTGACAGG + Intergenic
1073009084 10:100346511-100346533 GGCCGCACACACAGGCTGGCTGG - Intergenic
1074047593 10:109852656-109852678 TGCTGCACGCCCTGCAAGGCGGG - Intergenic
1075405717 10:122194416-122194438 TGATGCACCCTCTGCCTGGCCGG + Intronic
1075811202 10:125226427-125226449 GGCTGCACAGCCTCCTTGGCCGG + Intergenic
1076028782 10:127140517-127140539 CTCTGCACACGTTGCCTGGCTGG - Intronic
1076470783 10:130716619-130716641 GGCTGCAGATCCTGCAGGGCAGG - Intergenic
1076756064 10:132572389-132572411 AGCTGCACAGCTTGCCTGGGAGG + Intronic
1077327936 11:1971705-1971727 GACCCCACACCCAGCCTGGCCGG + Intronic
1077405375 11:2380167-2380189 CACTGCACATCCTGCCTGTCTGG - Intronic
1077578373 11:3401561-3401583 GCCTGGACCCCCTGGCTGGCTGG - Intergenic
1077849901 11:6065906-6065928 GCCTGGACAACCTGCCTGGAGGG + Intergenic
1078508580 11:11969097-11969119 GGCTGCCAGCTCTGCCTGGCTGG + Intronic
1079133451 11:17762831-17762853 GGTTGCAAAAGCTGCCTGGCGGG - Intronic
1079340634 11:19608895-19608917 GGCTGCCCACACTGCTTGGCTGG + Intronic
1080641714 11:34162302-34162324 GGCCCTCCACCCTGCCTGGCTGG - Intronic
1080896067 11:36449609-36449631 GGCTGCACACCCTGCCTGGCTGG - Intronic
1081760550 11:45573902-45573924 GGCTCCACAGTCTGCCTGCCGGG - Intergenic
1081796813 11:45826187-45826209 GGCTGGACTCACTGGCTGGCTGG - Intergenic
1082780822 11:57286283-57286305 GCCTTCACACCCTGCCTTCCAGG + Intergenic
1083318042 11:61828297-61828319 GGCTGCACACACCGGCTGGGAGG + Exonic
1083712408 11:64557305-64557327 GGCTCCAGACCCTGACTGCCGGG - Intronic
1084087287 11:66860401-66860423 GGCTGCAGCCCCTGCCTCGGTGG - Exonic
1084235408 11:67785075-67785097 GCCTGGACCCCCTGGCTGGCTGG - Intergenic
1084708612 11:70830284-70830306 GCCTGCCCTGCCTGCCTGGCTGG + Intronic
1084948751 11:72653196-72653218 GGCTGGACCTGCTGCCTGGCTGG + Intronic
1085339812 11:75723832-75723854 TACTGCACACCCAGCCTGCCAGG + Intronic
1085576275 11:77606619-77606641 GGCTGCAACCTCTGCCTCGCAGG + Intronic
1086839545 11:91667717-91667739 GGCTGCAGACCCAGGCTGGGAGG - Intergenic
1087901016 11:103641154-103641176 GCCTGCTCTTCCTGCCTGGCTGG - Intergenic
1088322499 11:108568331-108568353 GGCTGCTCACCATGGCTGGCCGG + Intronic
1088729810 11:112670908-112670930 GGCTGGAGACCCTGGCTGGGAGG - Intergenic
1088742840 11:112780929-112780951 GGCAGCCCAACCTGTCTGGCTGG + Intergenic
1089422821 11:118344352-118344374 TGCTGCACAGGCTGGCTGGCTGG + Exonic
1089654298 11:119935705-119935727 GACTGCACACCCTGCCCTGGTGG - Intergenic
1091596174 12:1880484-1880506 GGCTGTCCGCCCTGACTGGCTGG + Intronic
1092406922 12:8227800-8227822 GTCTGCACCCCCTGGCTGGAGGG + Intergenic
1095094856 12:38141312-38141334 GGCTGCACTCTCTGCCTCCCTGG + Intergenic
1096124791 12:49111138-49111160 GCCCTCACATCCTGCCTGGCTGG - Intergenic
1096243851 12:49973688-49973710 GGCTCCACATCCTCCCGGGCTGG + Intronic
1097187216 12:57202319-57202341 GGATGCCCACCCTCCCTGCCAGG + Intronic
1097251064 12:57632567-57632589 GGCTCCACACCTAGCCTGTCAGG + Intronic
1097253429 12:57653470-57653492 GACTGCAACCTCTGCCTGGCAGG - Intergenic
1097354479 12:58586178-58586200 GGCTGCAGAGTCAGCCTGGCTGG - Intronic
1099667862 12:85654163-85654185 GGCTGGAGACCCTGGCTGGGAGG + Intergenic
1100946006 12:99784526-99784548 GGCTGGTCTCTCTGCCTGGCAGG + Intronic
1102035482 12:109768571-109768593 CGCCGCACCCCCTGCCTGCCAGG + Exonic
1102780934 12:115563757-115563779 TTGTGCACACCCTGCATGGCAGG + Intergenic
1103614981 12:122146122-122146144 TGCTGCACACGCTGCCTGCCCGG - Exonic
1103700061 12:122844614-122844636 GGCCTCACACACAGCCTGGCAGG - Intronic
1103779053 12:123387616-123387638 GGCTGGAGACCCTGCCTTGAAGG + Intronic
1104990611 12:132621992-132622014 GACTGCAGACCCGGCCTGGTGGG + Intronic
1105422652 13:20266623-20266645 AGGTGCACACCCTGCCTTTCAGG - Intergenic
1105806328 13:23953606-23953628 GGCTGCACTGTCTGCCTGGGAGG - Intergenic
1106958700 13:34973232-34973254 GGCTGGAGATCCTGACTGGCAGG + Intronic
1107021992 13:35761262-35761284 GGCTGCCCACACTGGCGGGCTGG + Intergenic
1111072030 13:83182921-83182943 TTCTGCCCACTCTGCCTGGCAGG + Intergenic
1111235191 13:85400339-85400361 GTCTGGACACCCTGACTGGGAGG + Intergenic
1112644806 13:101318175-101318197 TTCTGCCCACCCGGCCTGGCAGG + Intronic
1113768665 13:112895319-112895341 GCCGGCACATCCTGCCTGGGCGG - Intronic
1113925556 13:113939677-113939699 GGCTGGACAGCCTCCCTGTCAGG - Intergenic
1114272108 14:21107187-21107209 AGCAGCACACTCGGCCTGGCTGG + Intergenic
1116774237 14:49161818-49161840 GCCTGTAAACCCTGCCTGTCAGG - Intergenic
1117096216 14:52300992-52301014 AGCTTCACTCCCTGCCTGTCGGG + Intergenic
1119484440 14:74978638-74978660 GGCTGCCCACTCTGCCTGGCTGG - Intergenic
1120597944 14:86464480-86464502 GGCTTCACACGCAGTCTGGCTGG + Intergenic
1121114665 14:91335314-91335336 CGCTGCACACCTTCCATGGCTGG + Intronic
1121782003 14:96627972-96627994 GGCTCTCCACACTGCCTGGCAGG + Intergenic
1122491182 14:102117046-102117068 GGGTGCACACCCAGCCAGGCTGG - Intronic
1122798177 14:104216745-104216767 GGATGCAGACACTGCCCGGCTGG - Intergenic
1122875079 14:104660205-104660227 AGCCGCACGTCCTGCCTGGCGGG + Intergenic
1122884947 14:104706822-104706844 GGCTGGACACCCTGGCAGACAGG + Intronic
1122887566 14:104717223-104717245 GGCAGCGCACCCTGCCCGGGGGG - Intronic
1122887582 14:104717262-104717284 GGCAGCGCACCCTGCCCGGTGGG - Intronic
1122887610 14:104717337-104717359 GGCAGCGCACCCTGCCCGGGGGG - Intronic
1122971062 14:105152424-105152446 GGCTGCAACCCCTGCCTGGCTGG - Intronic
1128094460 15:64943507-64943529 GGCTGCAGAGCACGCCTGGCAGG + Exonic
1128462742 15:67883636-67883658 GGCTGCTCTTCCTGGCTGGCTGG + Intergenic
1128516333 15:68344239-68344261 GACTGCCCGCCCAGCCTGGCAGG + Intronic
1128544539 15:68558273-68558295 TGCTGCTGCCCCTGCCTGGCAGG + Intergenic
1129971354 15:79780536-79780558 GGCTGGAAACCCTGGCTGGGAGG - Intergenic
1132510828 16:340527-340549 GCCTGCACTCCCTGGCTGGCGGG - Intronic
1132668047 16:1090853-1090875 GGCAGCACACACTGGCTGGGAGG - Intronic
1132760840 16:1507980-1508002 GCCTGCACACTCTGCCTGTGTGG - Intronic
1132867657 16:2101832-2101854 GGCTGCCCACCCTGACTGACTGG + Intronic
1133233699 16:4378118-4378140 GCCTGCACACCTGGCCTTGCAGG + Intronic
1133284816 16:4685803-4685825 GGGTGCAGCCGCTGCCTGGCGGG + Intronic
1133542559 16:6770640-6770662 GGCTGCAGAGCCTTCCTGGGAGG + Intronic
1134111401 16:11517549-11517571 GACTCCACAGCCAGCCTGGCTGG - Intronic
1134524121 16:14931282-14931304 GGCTGCCCACCCTGACTGACTGG - Intronic
1134548782 16:15129653-15129675 GGCTGCCCACCCTGACTGACTGG + Intronic
1134711712 16:16329767-16329789 GGCTGCCCACCCTGACTGACTGG - Intergenic
1134719564 16:16373066-16373088 GGCTGCCCACCCTGACTGACTGG - Intergenic
1134947862 16:18338819-18338841 GGCTGCCCACCCTGACTGACTGG + Intergenic
1134955116 16:18378926-18378948 GGCTGCCCACCCTGACTGACTGG + Intergenic
1135330655 16:21557174-21557196 GGCTGCGGCCCCTGCCTGCCTGG - Intergenic
1137711144 16:50567707-50567729 GGCTCCGCTACCTGCCTGGCTGG + Intronic
1138338639 16:56272565-56272587 GGCTGAAAATACTGCCTGGCAGG - Intronic
1138605311 16:58084913-58084935 TGCTGGACACCCAGCCAGGCTGG - Intergenic
1140195032 16:72848602-72848624 GGCCGCAGACCCAGCCTGGGAGG - Intronic
1141698430 16:85631567-85631589 GGCTGGACCCCCTGCCTGCTGGG + Intronic
1141805601 16:86339404-86339426 GGATGGACACACTGCCTAGCAGG - Intergenic
1142043679 16:87911641-87911663 GGCTGCGGCCCCTGCCTGCCTGG - Intronic
1142129194 16:88425027-88425049 GGCTGGAAGCCCTGCCCGGCGGG - Intergenic
1142471485 17:165577-165599 GGGAGCAAACCCTGCCTGCCAGG - Intronic
1142817321 17:2436673-2436695 GTCTGCACACACTGCCCAGCAGG - Intronic
1143359623 17:6358366-6358388 TGCTGCCCACCCTGCCCTGCAGG + Intergenic
1144853813 17:18257483-18257505 GGCTCCCCACCCTGCAGGGCAGG + Intronic
1145302676 17:21652247-21652269 GGCTGGGCAGCCTGCCAGGCAGG + Intergenic
1145347627 17:22050941-22050963 GGCTGGGCAGCCTGCCAGGCAGG - Intergenic
1145791245 17:27628636-27628658 TGCTCCACACCCTGCCTGGAGGG - Intronic
1145806811 17:27740174-27740196 TGCTCCACACCCTGCCTGGATGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147453258 17:40519215-40519237 GGCTTCACACCCTGGCTGTGGGG + Intergenic
1147934185 17:44002058-44002080 GGCTGCACCCCCTACCTGGTGGG - Intronic
1147969387 17:44211438-44211460 GGCTGGACTCCCTGCCTGGACGG + Intronic
1148736514 17:49868226-49868248 GGCTGGCATCCCTGCCTGGCTGG + Intergenic
1148748507 17:49931489-49931511 GGCTGGACACCATGCCTCTCTGG + Intergenic
1149238111 17:54616712-54616734 CTCTGCCCACCCAGCCTGGCAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150636274 17:66915390-66915412 GGCTGGACACCCTGGCAGGAAGG - Intergenic
1152572154 17:81125606-81125628 GGCTTTGAACCCTGCCTGGCTGG + Intronic
1152693793 17:81733972-81733994 CCCTCCTCACCCTGCCTGGCTGG - Intergenic
1153987874 18:10369015-10369037 GTCTGCCCTCCCTGGCTGGCTGG + Intergenic
1153998624 18:10463950-10463972 GGCTGCACTGCCAGCCTCGCTGG + Intronic
1156503416 18:37574276-37574298 GCGTGCCCACCCTCCCTGGCGGG - Intergenic
1156844280 18:41646138-41646160 GGCTGCTCACCTTCCTTGGCTGG + Intergenic
1157273634 18:46294867-46294889 GTCTGCCCATCCTGCCAGGCTGG + Intergenic
1157586437 18:48804288-48804310 GGCTGCACATCTTGTCTGGAGGG - Intronic
1160513209 18:79463880-79463902 GGCTGCTCTCCCTGCCTAGGGGG - Intronic
1160857946 19:1225862-1225884 GGCTGCCCACCCTGCCCAGGTGG - Intronic
1160921695 19:1523823-1523845 CCCTGCACACCCGGGCTGGCTGG - Intergenic
1162079899 19:8211508-8211530 AGCTGAACACAGTGCCTGGCTGG + Intronic
1162145316 19:8609550-8609572 GGCTGCACATCTGGCCGGGCCGG + Intronic
1162935714 19:13980511-13980533 GGCTGCAGAGGCTGCCTGGCCGG + Intronic
1163637211 19:18442637-18442659 GGCAGCCCAGGCTGCCTGGCTGG - Intergenic
1163840200 19:19603149-19603171 GGGGGCACACCATGCCAGGCAGG - Intronic
1164624085 19:29715169-29715191 GGCTGCAGCCCGGGCCTGGCAGG + Intronic
1165873711 19:38991189-38991211 GGCCACACACCCTTACTGGCCGG - Intronic
1167467776 19:49659162-49659184 GCCTGCAAAGCCTGCCTGCCTGG - Intergenic
1167610580 19:50506100-50506122 GGCTGCGCACACTGCATGCCTGG - Exonic
1167952320 19:53037442-53037464 GGCTGCGTCCTCTGCCTGGCGGG - Intergenic
1168699639 19:58429439-58429461 CACTGCACACCCTGCCTCCCAGG + Intergenic
925018401 2:549027-549049 CCCTGCACACACAGCCTGGCAGG - Intergenic
925508189 2:4593474-4593496 GTCTGAACACTCTGGCTGGCTGG - Intergenic
926099422 2:10104806-10104828 GCTGGCACATCCTGCCTGGCTGG + Intergenic
927865497 2:26584964-26584986 GGCAGCACTCCCCGACTGGCGGG - Intronic
928364518 2:30690999-30691021 AGATACCCACCCTGCCTGGCAGG - Intergenic
928488195 2:31754167-31754189 GGCTGCACCCACTGCCTAACCGG - Intergenic
928907500 2:36382599-36382621 TGCTGCACACCTGGGCTGGCAGG - Intronic
928980551 2:37131734-37131756 GACTGCATATCCTGCTTGGCGGG - Intronic
929576799 2:43057241-43057263 AGCTGCACACCAGACCTGGCAGG + Intergenic
930895255 2:56439071-56439093 GGCTGTACACAATGCGTGGCTGG + Intergenic
932422989 2:71612357-71612379 GGCTGCGCTCCCTCACTGGCTGG - Intronic
934747647 2:96770055-96770077 AGCTGCACCTCCTTCCTGGCTGG + Intronic
936084528 2:109457607-109457629 CGATGCACACACTGCATGGCCGG + Intronic
936286947 2:111188172-111188194 GGCTGCACACTCTGCCTCCCGGG - Intergenic
937222460 2:120349653-120349675 AGCTGCCCAGCCTACCTGGCAGG + Exonic
937980016 2:127609298-127609320 CTCTACACACCCTGCCGGGCAGG - Intronic
938312828 2:130304632-130304654 GGCTGCAAACTCTGCCTCCCAGG - Intergenic
938786833 2:134637401-134637423 GGCAGCACAGGCTGCCAGGCGGG - Intronic
941544976 2:166837773-166837795 TGCTGCCCAGCCTGCCAGGCAGG - Intergenic
941999018 2:171627704-171627726 TTCTGCCCACTCTGCCTGGCAGG - Intergenic
945929542 2:215841479-215841501 GGCCACAGACCCTGCCGGGCTGG - Intergenic
946323017 2:218964558-218964580 TGCTGGGCACCCCGCCTGGCAGG - Intergenic
946643943 2:221813890-221813912 GGCTGTACACGCAGCATGGCTGG - Intergenic
947869717 2:233427904-233427926 GGCTGCTCACCCTGCCCACCAGG - Intronic
947935262 2:233998660-233998682 GGCTGCTCACCCTAACTGGATGG - Intronic
948837237 2:240631651-240631673 GGCTGGAAACCATGTCTGGCAGG + Intergenic
1169331540 20:4720433-4720455 GGCTGCACTGCCGGCCTGGCTGG + Intergenic
1170824833 20:19784683-19784705 GGCTCCGGAGCCTGCCTGGCTGG - Intergenic
1170846855 20:19969396-19969418 TGCTGCTCACTCTGCCTGGAAGG + Intronic
1172263398 20:33589247-33589269 GGCTGCTCTCTGTGCCTGGCTGG - Intronic
1173608894 20:44352238-44352260 GGGCCCACTCCCTGCCTGGCTGG + Intergenic
1174051746 20:47771791-47771813 GGATGCTCATCATGCCTGGCTGG + Intronic
1174593771 20:51667532-51667554 GGCAGCTCACCCTGCCTGGAAGG + Intronic
1174812338 20:53657705-53657727 GGTTGCAGACCCCTCCTGGCTGG - Intergenic
1175575920 20:60060710-60060732 GGCTGCACAGCCAGCCTGCCTGG + Intronic
1176058760 20:63162591-63162613 GGGCGCTCACCCTTCCTGGCAGG - Intergenic
1178907230 21:36646737-36646759 GGTAGCACTTCCTGCCTGGCAGG + Intergenic
1179407251 21:41136344-41136366 GGTTGCACACTCTGCAGGGCTGG + Intergenic
1180050256 21:45327805-45327827 TGCTGCACACCCAGCCCTGCAGG - Intergenic
1180875154 22:19171749-19171771 GGCGGCCCTCCCTGCCTGGATGG + Intergenic
1180966015 22:19788322-19788344 GGCTGAGCATCCTGCCTGGTGGG + Exonic
1181402843 22:22661732-22661754 CTCTGCACAGCCTGCCTGGAGGG - Intergenic
1182027677 22:27133237-27133259 GGCTGCACAACCTGGCAGGCGGG + Intergenic
1182316758 22:29452888-29452910 GGCTGGACACCTGGCCTGGAAGG + Intergenic
1182584613 22:31337207-31337229 GGCTGAGCACCGTGCCTGCCTGG - Intronic
1182792687 22:32966206-32966228 GGCACCTCACCCTGCCTGGATGG + Intronic
1183061341 22:35338126-35338148 GCCTCCCCACCCTGCCTAGCTGG + Intronic
1183213927 22:36467194-36467216 TTCTGCACCCCCTGCCTGGGAGG + Exonic
1183631306 22:39034527-39034549 GGCTGCTCCTCCTGGCTGGCAGG + Intergenic
1183955326 22:41376759-41376781 CACTGCACACCGTGCCAGGCGGG + Intronic
1183985932 22:41570429-41570451 GCCTGAACACCCTGCATGGCAGG - Intronic
1184865682 22:47200753-47200775 TGCTGCCCACTCGGCCTGGCAGG + Intergenic
1185127620 22:49020242-49020264 AGCTGCACATCCTGCCTAGAAGG - Intergenic
950768636 3:15292923-15292945 GGTTGCACCTCCTGCTTGGCTGG - Intronic
952302315 3:32114139-32114161 GCCACCACACCCAGCCTGGCTGG + Intronic
952376026 3:32768037-32768059 GGAGGCCCACCCTGCCTGGGAGG + Intronic
953103407 3:39852317-39852339 GGTTGTACTCCCTGCCTGGGTGG - Intronic
957051378 3:75414879-75414901 GCCTGGACCCCCTGGCTGGCTGG - Intergenic
957051979 3:75418236-75418258 GTCTGCACCCCCTGGCTGGAGGG + Intergenic
957307907 3:78481334-78481356 TTCTGCCCACTCTGCCTGGCAGG - Intergenic
959620007 3:108389784-108389806 GGCTGCTCCCCCTGCCTAGGGGG + Intronic
961201391 3:125048464-125048486 GGCTGCTCCCCCTGCCTGGAAGG + Intronic
962236985 3:133715105-133715127 GCCTGCACTTCCAGCCTGGCTGG + Intergenic
964335436 3:155649436-155649458 GTGTGCACACCCTGCCTGAAGGG - Intronic
964517783 3:157531516-157531538 GGCCGCACACCCAGCCTGAAGGG - Intronic
968478485 4:823882-823904 GGCTGCACGTCCCGCCTGGGAGG + Intronic
968522568 4:1040681-1040703 CGCAGCCCACCCTGCCTGGGTGG - Intergenic
968760913 4:2442483-2442505 GACTGCAGGCCCTGCCTGGCCGG + Intronic
968994157 4:3935251-3935273 GCCTGGACACCCTGGCTGGCTGG - Intergenic
968994781 4:3938611-3938633 GTCTGCACCCCCTGGCTGGAGGG + Intergenic
969029780 4:4202715-4202737 GGGTGGGCCCCCTGCCTGGCTGG + Intronic
969436198 4:7191108-7191130 GGCTGCAGACCGTGGCTGGCAGG - Intergenic
969614147 4:8242575-8242597 GGCTGCAGGCCCGGCCCGGCAGG - Intergenic
969706646 4:8796003-8796025 GGCTGTCCACTCTGCCTGCCTGG - Intergenic
969759220 4:9170183-9170205 GTCTGCACCCCCTGGCTGGAGGG - Intergenic
969819773 4:9710985-9711007 GCCTGGACCCCCTGGCTGGCTGG + Intergenic
975378772 4:73674512-73674534 GGGTGCACACCCCGCCTTACTGG - Intergenic
984373272 4:178894278-178894300 GGCTGTACACTCTGGCTGGCTGG - Intergenic
985648281 5:1095392-1095414 AGCTCCTCACCGTGCCTGGCTGG - Intronic
986329089 5:6704383-6704405 GGCTGGACACAGAGCCTGGCTGG - Intergenic
987259196 5:16186777-16186799 GCCTGCACACTCTGGCAGGCTGG + Intergenic
989457578 5:41661273-41661295 GGCTGCACACTGTGCATGGAAGG - Intergenic
991143418 5:63273540-63273562 GGCTGGAGACCCTGCTTGGGAGG + Intergenic
991999141 5:72418106-72418128 GGCTGCACATCCTGCCTCCCTGG - Intergenic
992529503 5:77640986-77641008 GGCTCCACACGCTGTCTGGAGGG + Intergenic
992831592 5:80598586-80598608 CACTGCAAACTCTGCCTGGCGGG + Intergenic
992911697 5:81401423-81401445 GGGTGCCCACCGTGCCAGGCTGG + Intergenic
994277463 5:97855754-97855776 GGCTGGAAACCCTGGCTGGGAGG - Intergenic
998143411 5:139712145-139712167 GGCTGGCCAGCCGGCCTGGCTGG + Intergenic
998399045 5:141838422-141838444 GGCTGCTCAGCCTGCCAGGCGGG + Intergenic
998848311 5:146331882-146331904 GGCTCCCCTGCCTGCCTGGCTGG - Intronic
999146422 5:149398828-149398850 GGCTGCAAACTCTGCCTCCCTGG - Intronic
999170265 5:149588324-149588346 GCCTGCACTCCATGCCAGGCTGG + Intronic
999375994 5:151086945-151086967 AGCAGCAGACCCTGGCTGGCAGG + Intronic
1000342084 5:160285700-160285722 CTAGGCACACCCTGCCTGGCTGG - Intronic
1000344546 5:160303952-160303974 GGCTGGGCACCCTGGTTGGCTGG - Intronic
1001515594 5:172353362-172353384 AGCTGGCCACCCTGCCTGCCTGG + Intronic
1002419102 5:179136273-179136295 GGCTGCACCAACAGCCTGGCTGG - Intronic
1002639663 5:180624782-180624804 GGATGCACACCCTGCCCAGAGGG - Intronic
1007090415 6:39180903-39180925 TGCTGCACTCCGTTCCTGGCAGG - Intergenic
1007332381 6:41123073-41123095 TGCAGCACCTCCTGCCTGGCTGG + Intergenic
1007507361 6:42346271-42346293 AGCAGCACCCCCTGCCTGGAAGG - Intronic
1007821136 6:44561396-44561418 GGCTGCGCTCCCAGCGTGGCTGG - Intergenic
1011669684 6:89671104-89671126 GCCTGCTCACACTGCTTGGCAGG + Intronic
1012045691 6:94270186-94270208 GGCTGCAGTGCCAGCCTGGCAGG - Intergenic
1012505818 6:99944934-99944956 TGCTGCTCTACCTGCCTGGCAGG + Intronic
1012521273 6:100124240-100124262 TGCTGCACAAATTGCCTGGCAGG + Intergenic
1012556405 6:100518106-100518128 GGCTGCAAACCAGGGCTGGCTGG - Exonic
1014525274 6:122495071-122495093 AGCTGTAGATCCTGCCTGGCAGG - Intronic
1016157239 6:140825875-140825897 GCCTGCACATCCTACATGGCTGG + Intergenic
1017776607 6:157685873-157685895 GCCAGCACAGACTGCCTGGCCGG - Intergenic
1017859838 6:158385455-158385477 GGCTGCACATCCTGGCTTTCAGG + Intronic
1018899618 6:168044524-168044546 GGCTGCTGACCCTCCCTGACCGG + Intronic
1019180746 6:170186219-170186241 CACGGCACACCCTGCCTGGCAGG + Intergenic
1019625549 7:2014059-2014081 GGCCTCACACCCTGCCCGTCAGG + Intronic
1019754620 7:2759932-2759954 GCCTACACAGCCTGCTTGGCAGG - Intronic
1022804494 7:33807951-33807973 CGGTGCACAACCTGCCCGGCAGG + Intergenic
1024988104 7:55213351-55213373 GCCTCCACACCCTGGCTGCCTGG + Intronic
1025279753 7:57618721-57618743 GGCTGGGCAGCCTGCCAGGCAGG + Intergenic
1025304979 7:57846780-57846802 GGCTGGGCAGCCTGCCAGGCAGG - Intergenic
1026452933 7:70545207-70545229 GGATGCAGACCATCCCTGGCTGG - Intronic
1033473013 7:141665814-141665836 GTCTGCCCACCCTGCCTAGCTGG - Intronic
1034555697 7:151849166-151849188 GGCAGTGCCCCCTGCCTGGCAGG + Intronic
1034969959 7:155412769-155412791 GTGTGCACACCCTGCCAGGGAGG + Intergenic
1034970900 7:155418515-155418537 GGCTGCTCTCCCTCCCTGCCTGG + Intergenic
1035016284 7:155769355-155769377 GGGCGCACAGCCTCCCTGGCTGG + Intronic
1035654073 8:1292381-1292403 GGCAGCTCTCCCTGACTGGCAGG - Intergenic
1035928139 8:3752071-3752093 GGGTGCACACCCAGGCTGGGTGG - Intronic
1036789559 8:11708875-11708897 TCCTGCACAGCCTGCCCGGCCGG + Exonic
1037562668 8:20088779-20088801 GCCTGCACACCCTGACAGTCTGG + Intergenic
1037819045 8:22126997-22127019 GGCTGCAGGCCCTGCGTGGGAGG - Intronic
1037882620 8:22580321-22580343 GGCTGCCCAGGCTGCCAGGCAGG - Intronic
1039821821 8:41141671-41141693 GGCTGCAAGTCCTGCCGGGCTGG + Intergenic
1041678420 8:60561052-60561074 GGCTCCAGCCCCTGCCTGGCAGG + Intronic
1045752427 8:105501256-105501278 GGCTGCAAACTCTGCCTCCCAGG + Intronic
1046002401 8:108436802-108436824 TGCTCCACACCCTCTCTGGCAGG + Intergenic
1047313049 8:123708444-123708466 GCCAGCCCAGCCTGCCTGGCTGG + Intronic
1048881619 8:138876842-138876864 GGCTCCACACTCAGCCTGACCGG + Intronic
1049358894 8:142202479-142202501 GGGTGCACTCCCTGAGTGGCAGG + Intergenic
1049418221 8:142505241-142505263 TGCTGGACCCCCTGCCGGGCTGG + Intronic
1049657467 8:143805119-143805141 GGCTCCACACCCTACAGGGCTGG - Exonic
1051352187 9:16207367-16207389 TGCTGCACATCCTGCCTGTCTGG - Intronic
1051711408 9:19934572-19934594 TGCTGTGCACGCTGCCTGGCAGG - Intergenic
1057219480 9:93248226-93248248 GGGTCCACACCCTGCATGGTGGG - Intronic
1057225100 9:93288995-93289017 CCCTGGACCCCCTGCCTGGCTGG - Exonic
1057819073 9:98317419-98317441 GGCTGCACAAACTGACAGGCAGG + Intronic
1058200140 9:102028586-102028608 GGCTGGAAACCCTGGCTGGGAGG + Intergenic
1060156576 9:121324546-121324568 GACTGGGCACCCTGCCTGGAAGG - Exonic
1060749327 9:126158687-126158709 GGCCGCTCACTCTGCCTGGCTGG + Intergenic
1061574368 9:131496883-131496905 GGCTCCATACCCTGCCCTGCAGG + Exonic
1061754303 9:132802196-132802218 GGCTGCACCACGTGCCTGGGAGG - Intronic
1062190955 9:135247614-135247636 CCCAGCACACCGTGCCTGGCAGG - Intergenic
1062690074 9:137837108-137837130 GGCTGCTCCCCCTGCAGGGCTGG - Intronic
1203688913 Un_GL000214v1:23665-23687 CCCTGCACACTCAGCCTGGCAGG - Intergenic
1203647362 Un_KI270751v1:80388-80410 CCCTGCACACTCAGCCTGGCAGG + Intergenic
1189078141 X:37939904-37939926 CGCTGCAAACTCTGCCTGCCAGG + Intronic
1190476276 X:50830937-50830959 GGAAGTACACCCAGCCTGGCAGG - Intergenic
1190963813 X:55278422-55278444 GGCTGCACCCACTGCCTAACCGG + Intronic
1192922336 X:75719889-75719911 GGCTGCACCCACTGTCTGGTAGG + Intergenic
1193151254 X:78127010-78127032 AGCTGTACACCCTGCCTAGAGGG - Exonic
1193554134 X:82932545-82932567 GGCTTCAGACCCTCCCTGACTGG - Intergenic
1195164304 X:102203093-102203115 GCCTGCACATCCTACGTGGCTGG - Intergenic
1195194556 X:102484002-102484024 GCCTGCACATCCTACGTGGCTGG + Intergenic
1196191847 X:112803004-112803026 GGCTGAGCACCCTTCCTGGAGGG + Intronic
1198648692 X:138837636-138837658 GGCTGCAGGCCCTGGCTGGGAGG + Intronic
1199589214 X:149450948-149450970 GGCTGGAGACCCTGGTTGGCAGG + Intergenic
1199687978 X:150281239-150281261 GGCTGGAAACCCTGCCTGACAGG + Intergenic
1201364084 Y:13184971-13184993 GCCTGCACCCACTGTCTGGCAGG + Intergenic